Description :
From Genome Similarity Track
Location :
Scaffold_896:10436- 11669
Sequence
1233 bases(100 bases per row)
CGGTAACTGGGACATTCTCAAAGTCTTTTTTTAGCGTGAGCTTGTGCGCGAGCGCGTGAAGGTTCTTGAAATGGCTGCCTCATGTGGTCACTTGGCCGTT
GTCAAGTGGCTCCACAAAGAGAAGGAGGTCACAGACGCCGGCAGAGGATACTTCCTAGCCGCCAAGGCCGGCCACCTCAATGTGTTGGAGTACTTGTACG
AGAAAAAACTAGACTATATAGACCGTGGTGCtatggatgctgctgctgaaatggGATTTCTTCCGATTGTTCAGTGGCTCCACGTGCACACTGAAGCCCA
ATGTACAAAGAACGCCATGGgcgatgcagcaggtcgGGGACACCTTGAAATGGTGCAATGGCTCCACAAGAACCGCACAGAAGGATGCAGCTATTTGGCG
ATGTATAGTGCCGCTGAAAACGGTCACCTCGACGTGGTAAAGTGGCTTCACTCAAATCGAACCGAGGGCTGTGATATTTCAACGATGAAGAGGGCTGCAG
GGCGTGGCGACCTAGATATGGTGATGTGGCTACATGACAATAGACGTGAAGCCTTTGGCCTTGAGGGGGCTATTGATACAGTCGCCGCACATGGGCATTT
GACAGTTCTGCAATGGTTGCATGTGAATCGTAACGAAGGATGCACTACTAGAGCTatgaatgctgctgctgcaaatggcCATCTTgaggtggtgaagtgg
cTCCACGAACACCGCACGGAGGGGTGTACCCAACAGGCAATGGATGAAGCCGCCACATACGGACATCTGGAAGTGGTAGTGTGACTGCACACTAATCGAA
GTGAGGGGTGCTCTACGAGGGCTATTGACGCAGCGGCAGGGAACAACCATCTAAACGTAGTGAAATGGCTTTGTCGCCATCGCTCACTACGGTGCACGCC
CTACGCTCTTGAATGGCTTTTCAGAAGGTCGAGACGTCTTGATACAGCCGTGTGTCTCTTCTCGGAATTTCCAGAGTGTCGAACATTCCATTTGGGACGA
GAGTTCCAACTTTCACGGCTGGAGGTTGTGGAATGGCTGCTTACCCACGCACCAAGTGCACTGGAAGGGTGTATACTGAAAATTGATTTTTGGAACTGTA
CATCTGTAATTGGTTGCGACAGAACAACTGGCGGGTGGTTAGCGAGGACCAGAAAATTACACGTTTTACTCAGAAAACAGGGGATACCATGAATTAAAGA
CTAGTGGTAGAGCAACTCGCTTTGATACATCGG