Description :
From Genome Similarity Track
Location :
Scaffold_15:104359- 106837
Transcript NameFunction/comments
Sapdi_VS20SDRG_05622hypothetical protein

Sequence
2478 bases(100 bases per row)
ATGGTGCCCGGGGCGCTCTGCTACGTGCCCGATGAGGTCGACGTATGGCTGCCGGCCGAGGTCGTCGGGCAGAAGGCTGGCACGAAGCAGATCACATGCA
AGGTCTGGACCGTCGACGGCCACGTCGAGGAGCGCGTGGTTGACCTCGATGACAAGAAGACGCGCGCGCTCATGAGCGGCAAGGGCGAAGCCATGGACGC
CGTCGACACGCTGCCGTTCCAGAACGAAAACGTCGGCGACGACGGTATCGAGGACATGATCACATTGAACTACCTCCATGAGGCTGCCATCTTGTACAAC
GTCAAGAAGCGCTTCCTGCGCGAGCTCCCGTACACGTACACGGGCACGATCTGCATTGCTGTCAACCCGTACAAGTGGCTGCCCGAGCTGTATGCGGAAG
AGCAGCACGTGCGGTACCTCAACATCCCGCGCGAAGAGCTGCCGCCGCACGTGTACGCGACGTCGGTCGCGTCGTACGAGAACATGAAGACGCACAGCCG
CAACCAGTCGATTCTTGTCAGTGGCGAATCCGGCGCGGGTAAGACCGAGACGACCAAGATTCTCATGAACCACCTCGCGACGATCGCCGGTGGCATGAAC
GATGGCACGATCAAGAAGATCATCCAAGTCTCGCCGCTGCTCGAGTACTTTGGTAACGCCAAGACGGTCCGCAACGACAACAGTTCGCGCTTCGGCAAGT
TTACCCAGCTCCAGTTTGACCGCGCGGGGACGCTCGTCGGCGCCAAGTGTAAGACGTACCTTCTCGAGAAGACGCGTGTCATTGGCCACGAGTTTCCCGA
GCGCAATTACCACATTTTCTACCAGGTACATGGCAATGCATGCAGCGGATCGGTTCTCACGTTGCAAACTGTAGCTCATTGACTCGGGGGACATGGCCAA
GACGCTCTTCCTCGACCAGGACGCCACGTACCGGTACATTGGTGAGAAGAGCACGGCGCTCATCGAAGGCAAGTCGGACGCACACCACTTTACGGTCACG
GCCGAGCGCCTCAGCCTCATCGGCTACTCGGCGTCGGCGCAGCTCGACCTCTACAAGACGCTTGCCGGTATCTTGCACCTCGGCAACATGCAGATCATCT
CGGACCCGTCCGACGACGAAAAGTCGATGATCGCGCCCGGCGACGTGTCGGCGACGTACATTACGCAGCTCATGGGCCTCACGATGGAGTCGCTCGAGAA
GGCGCTCTGCTCGCGCACGATGCGGGCGCGCAACGACGTGTACAGCGTGCCACTCAAGAAGGTACACGTCCCATGTTGTGGCGACAGTCTCTCATCGAGC
TATCCTAGAGCGACGCGGAAGCGTGCTTGGACGCGCTCGCCAAGGCCATTTACTCGCGCGTCTTTGACTGGCTCGTCGAGCTCATCAACTTGTCGCTGTC
GAACGACGCCAAGATGACCAACCACATTGGCGTGCTCGATATCTTTGGGTTCGAGCACTTCAAGTTCAACTCGTTTGAGCAATTTTGCATCAACTACGCC
AACGAGAAGCTGCAGCAAAAGTTCACGTCGGACGTGTTCAAGACGGTACAGATCGAGTACGAGGAAGAGGGCATCCAGTGGGAGCACATCGAGTTCTCGG
ACAACCAAGATGTGCTCAACGTCATCGAAGACCGCATCGGTATCATCTCGCTCCTGAACGAAGAGCTCAAGAAGACCAAGGGCTCGGAGGCCGGCTTTAT
GTCGACGATCTCGTCGATCAACAAGGACCTGTACAAGCCCAGCGTCATCGAGTTTCCGCGTACGTCGCGCACCGAGTTTATCATCAAGCACTACGCGGCG
CCTGTCAAGTACGAGTCGCTCGGGTTCCTCGAGAAGCACAAGGACAACCTGCTCCCGGATCTCTCGGACCTCATGCGCGGCTCGGACACGACGTACATCC
AAAAGCTCTTTGAAGAAAAGGTCGTCGAGGTCAAGAAGGAAGAGGTACCGGCCGGTCGCCGTCGTGGCGGTACGCTCAACATCTCGACCGTCGGGTCGCA
GTTCAAGGACAGCTTGACGGAGCTCATGACGACGATCCAGTCGACGAACGTGCAGTACGTGCGCTGCATCAAGCCCAACTCGATCAAGAGCGCGACGACG
ATGGAGAACGCGATGGTTGTCTCGCAGCTGCGCTGCGCCGGTGTCATTGAAGCCATTCGCATCTCACGCGCTGCGTACCCGAACCGACAGACGCACGAAG
AGTTTTTGGCCAAGTTCCGCCTCTTTGTGCCAGCGGGCCCTGGCAAGCCGCGCGAAAAGTGCGAGCAGCTCATGACCAAGCTCAAGCTCACGTCGCCCGC
GCAGTACCAGATGGGGTGGACCAAGATCTACTTCCAGCTCGGCGTGCTCGAGGAGCTCGAAGACCGTCGCAAGAAGTTCTTGGACAAGAAGGCGCGCTTC
CTCCAGAAGATCATGAAGGGCTTTACCCAGCGCATCAAGTACCTGCGCCAGCTGCGCGCGATCGTCAAGCTCCAGTCG