Description :
From Genome Similarity Track
Location :
Scaffold_15:104358- 106836
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05152DNAdependent RNA polymerase putative

Sequence
2478 bases(100 bases per row)
TTCTCCCACTGGCACGAGGGTTCAAACTGCATGCGACAGCAAGCGCTGGACGTCCGTGCTCGTCACTTCTACTCTCCGTTGGATTGCGACACGCGGACGT
CGACCCACATTTCTTTTCTGATTTCTTATTGTGGCAACTCGCTCACCAGAAATGCAATGTAGATTGTGAAGAAGAACCGCGAGTTCCACTCGCTGCGCTG
CGACACGATCTACAAGCTCCAGGTCGCCGAAGAGTTTCAGCACGAAGAGGCCATCTACTTCCCGTACAACATGGACTTCCGCGGCCGCGTGTACCCGATC
CCGCCCAACTTAAACCACCTCGGGTCGGACATGTCGCGGTCGCTCCTCGTCTTCAAGGACAAGAAGCCGCTCGGCCCCGGCGGCCTCCGCTGGCTGAAGA
TCCACCTCGCGAACCTCTACGGCATTGACAAGTGCTCGTTCGACGATCGCGAACAGTTTGCGACCGACCACATGCAGCAGATCCTCGCGTCGGCTGCCAA
CCCGCTCGGCGACGACCCGGACTCCAAGTGGTGGCAGGACGCCGAGGCGCCGTTCTTGGCCCTCGGCGTCGTCTTTGAGCTGGCCAAGGCCGTCCAGCAC
CCGAACCCGGAGGAGTACCTCTGCAACGTGCCCGTGCATCAAGACGGGTCGTGCAACGGACTTCAGCACTACGCTGCCCTCGGTCGCGACCAGGGCGGTG
GCGAGCAGGTCAACCTCGTGCCCTCGAACAAGCCGCAGGATGTCTACTCGGGCGTCGCGGCCCGTGTCATCCAGCGCATGGAGCACGACTCGGTGCAGGC
CGTGCCGTCGCTTGACGAAATCATCGACGACCTCCGCCGTCCTTTGAGAAGACGTGGTACGAGGACGAGAAGCTCGGCGCGCCGGCCAAGACGCGCCGGT
CGTCGTACGTGCCGAAGAAGGCGCTCACGAAGGAGGAGACTCTTCTTCGTCTTGCCAAGGCCAAGGAGTTCGAGCTCAAGCGCCGCCACGAGTACGCCAA
CCTCCTCCTCAAGTCGATCACGCGCAAGGTCGTCAAGCAAACCGTCATGACGTCGGTGTACGGCGTCACGTACATTGGCGCGCGTCGCCAGATCCAAGCG
CGGCTCGAAGAGGTCTTCCTCATGGAAGGCCGCGGCATGAACGAAGAGCTTGAAGAACAGATCTACCACGCCGCCAACTATGCCGCCGAGCTCACGATGC
AGTCGATGGGCGATCTCTTCACGTCCGCGCGTCTTATCATGGAGTGGCTCTCCAAGTGCACGGAGCTCGTCGCGAACGAGGGCCAGATGATGAGCTGGAT
CACGCCGCTTGGTCTCCCCGTCACGCAGCCTTACCGCGTTCAGAGCTCCAAGCAGGTCCGCACTTCGATGCAGCACGTGATCATCACGGACAATGACTCG
AAGCGCGTCAGCGTCGGCCGCCAGAAGTCGGCGTTCCCGCCCAACTATGTGCACTCGCTCGACTCGACGCACATGATGATGACGTCGCTTAAGGTCATTG
GCGAGGACAAGCTCGACTTCGCGGCCGTGCACGACTCGTACTGGACGCACGCGTGCTCGGTCGACCGCATGAACGAGCGATTGCGCCAGGAGTTTGTGAC
GCTCTACTCGCAGCCGCTGCTGCAAGAGCTCCGCGACCAGCTCGTCATGCGCTTCCCGCGCCAGCAATTCCCGCCCGTGCCCGAAGTCGGCGAGCTCGAC
CTCAAGGAAGTGCTGGAGAGCCCGTACTTTTTCAACTAGATTTCCATTCCTCGTATTTAAGAACAAGATGGCACCCAATTACCGCTATTAAAACAACTAA
GACACTATGTACACTTATCCTTATTGCCATTTGACCGGTGCTCAGACTCTTGCCTAGCCCGCCTGCGTCTACCAGCTCACGGACAGCTTGACGGATCGAT
GCAATGCGACGATGGACCACGACGCCACCGTCGCGGCCATGGACGAGCGTCTCCAGATGCTGAAGGCCGGCGTCGACCGTCAGCAAGATCGCATCAATAA
ACTACTGGGTCAGCCCACCGTGGCCAAGATGGCTACGGGGTCAGCTTACCGTGGCCAAGATGGTTACCGGCAGCGCCCAGCGTCTTCACAAAGCGAGACC
AAGGAAGCGGCCCTCCGCCAGCTTCAAGTCGAACTCGACATACGCGTCGAGCTCGCTCAGAAGCACGATGGTGTTGTCACACCAGCTTCAGCGTGCTGTG
GCCACCAAAGACGAGGTTTTGGCCGCACACGAAGGTCAAATCCGCGATCTCCAAGGTCAACTTCAAGTCGTCCAAGCCAAGCTTAGAGTCGGTGCAGCCC
GCGCTCATGCAACGTCCATCGAATCCGAGGACGAGCAGATGCACATGCCCCAAGAAGATCTCGAGGTACCAAGTCGCAGCACTCGTTCGCACGCGCGATC
AGCTCCAATGCAATGTGGCAGAGCTCCAATCCGACGGGATCGAGCTCCAAGATCTGACTTGCCAGCTCCAAGGCGATC