Description :
From Genome Similarity Track
Location :
Scaffold_6:1043316- 1047288
Transcript NameFunction/comments
Physo_336569Hypothetical protein
Physo_336570Eukaryotic/viral aspartic protease, active site

Sequence
3972 bases(100 bases per row)
CCGGATACTGCTTGGCCGGCGATCGCTGCGTCTCTCAATCGACCTCGATCCCGCTATAGGAAGCGGCAAGCAACTCAGGAAAGGAAGGAACACACCCGGA
AAGGCAACTAGAGGCCTTGGATCTACTCCAGGCCGACCGATCGAAGCGAAGAACCCTCGATCGGAGCGTATACTCGGACGCAGAGCGAAGACTACCGCGC
TGCTCCGCAAACTATCCCCGCGTCACGCCAAGACACTCGATCTTCACCAGGTGCTGCATCTTCGGAGCCCCGAGAGAGCAGATCCAGCCCGCCGACGGGT
ACACAAGGTGAGAACAAGTTCAGCCGATCACGGATCGTTGGGGGACCCCCTCCGTTAGTCGGTGTCCGGGCGCTGGTGGGAAGCTCGATCAGGCCTTAAC
CAGATTTTGGCCGATGCCGCTACCCCACAATGGTGCGCGTGCCCGAATCTCTTGGGGACTCCGGATTTCACCGTGAGTCCGTAGAAGATGCGCAAGTGAA
GAAAGAACCAGGGGAAGAGGCGTCGTCGGATATCGGATCGACGAAGACGCTGCTGAACAAAACGAGATCCGCGGATCGACAGAGGACTTCTGTCGACGGA
ATCGAGGGCGATCTGGAGACAGATCTAGAAGACAAACCTCAACATCCTCCCCAGGTCCCTTCGGGGACCCCGGTGGATCTTGGTGCGAACCGAGATTCAC
TAACAAAACAAACTAAGGCGGGATCGGACCGATACGCGTTCGCTGACTCGCCGATCAGGCTCGATCCGGGCTATCTGGACGCGATCGCGGACAAGACCCA
GATCGTGAGGAAGAAGCTGAGAGCGCCAGGCTTGGACGACGAAGATCCCAGACCGTCGGCGCTCGACTGGTCTGAGGCTGACCTGGATCGTCAGTATTAC
TTGAAGGAACTGCGAGATTTCTTGCGTCAAGATCCTGTCATGGTGATCGTGCGGCCAGAGCAGATCGACGACCCGAAGGGCCCGATTTCGGCCCCCCGAG
TGACGGATAACAAGCTGATGGCGGTGAAGAACCTGCTCGGGCTGTTGAAGGAAGCCGGCTTCGTGGCTGGCGCCTTTGAAGCGAACGATCTTTTCGATCA
AGATCTCGATGTGATCCAGACAGCGATCCAGACATTGGTCGACAAGTTGAGACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGATACGTCGTCTGAACCCCAACGGATGTCCCTCGGCCCTTCAG
GATCTGCGATGTTGGACGCGCGATCACGGAGTCAACGTCAGGAACGCATGCGGTCAGGACCTCGGAAGCAGAAACCCAAGTCGACCGATCGGACCACCAG
TGCCACCGGATCAGATGAGTCGAATGGCAGATTGGAGTCTTACTTTCAGGCTGCGATGACTCGATTTCTGAAGGAAGAACAGGCCACGGTGGTAACACCT
ACTCCAGTGGTCGACGACAACGTTGGATCGCGGGACGTGGAGACGGAATCAGCCGGATCACCGGACCAAGATCTCTCCCAGTGGGAATACGATCCGGACG
ATATTGATCTACCGAGTTCGGCCCCTGCTGCGGTGGCCACCGCTGCCTCGGGATCCACTGGGTCCTCCTTGATCCAGCACGTGCGAATCTCCGCGATGTC
CGATCTCAAGGAGTTCAGTGGCAAGGATCAGGACGAAGATCGCGCCCGATCGTGGATCAGCAAGGTGAAATCGACGTTCCTGCTAGATCAGGCTACGGAC
GAAGAGAAGTGCTTGACCTTCGCTGATCTACTGACGGGCCCGGCGAAGAACTGGTACCACCAGCTGGGCCGATCGACGCGGAACAAGTGGAGCGATCTAC
TCCGGAATTTCCAGATCCAGTATTGTGGCCTGGGAGTATCGGTCGCTTGGCAGTATTATCATTCTCGCAAGAGATCGGATGAATCGCCGTTGGAGTACCT
CTATCGACTGAATGTGGCGGCCCTACGTGCAAGATTGAAGATCAAGGACGGGGATTCCAAGGCCCGCCGAGAACATGTCAAACACTTTATCGAGACACTG
GGCGATCCGGAGCTGGCCGATCAGCTCACCCTACTCCGGCTTGCGGACGCGGAAGATCTGGAGGAAGTCCTGCGCGCTCGAGAGCGCGCGAAGAGTAGAC
AGCAGCGATCCGCCTTTGGATCGAAGTATCGTCAGAAAGTTCCGACCTCAGCACCAGCTGCTGCAACCAAGCGGGCAGTGCGTGCAGTGCAGATCGCGAG
CCAGGAGTCTGGATCGGACTCGGGATCAGACGGATCGGACTCGGGATCAGACGGATCGGACTCGGAGGGTGATCTACGTCGCGTTTACCTAGCATCGGCC
GAGGACAAGTCCCGCAACGCTGGGGGCGACGCGACGAAGCCGGATCGAAGCAACCAGGCGCAGATCAACCATGACCCACCTCGATCGGATCCACGATCGC
GATCTTCACCTGACGGATCGGAGCGATAAACCGCTGCTCACATTGTGGATCGCGGAAACACACCGGTCTCGATTGTTGGAGACGTTTGACGTGCGAGAAG
TGTGGCAAGAGAGGTCATCCGGCGGATCGCTTCCTGTTTGTGTGCCGTGGATGTGGTGAACTACACGAGATGGGCAAGTGTCCGATGGAGGAAATCTACA
ACCAGATCCGTCAATGGTTCAACCCGGTGAAGCACGCTGGCATGTTGCCCGCGATCCCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTGGAATCCG
GTACGAGCCGAGCGTTCTAGGTACTGCATCTATGCATTCGTGAACAAGAACACGGTAGATCGAGTAAGTGGACGGACTGATCTACGCGGTAATACATGTG
ATCTGCATGCGAAATATGCCGCCAAGGTCTTAAGTCTACATCGATCGGACAACTTCAGCCGTTCTGACGCCGAAGTGCCCTTGGATCTCCAGTTTGGAGA
AACGCGGGGCTATTGGAAGCAACGCAGACCGGAGGAATGGTTCAACCCAGCTGATGGCGAAGTGACGACCGAGATCCCGGAGCATGATCGCGATCGAAGT
CGGCCTCGCGTCAGCGAACACCGCAGATCTGGTGATGTGGTGCCCTATCTCCTCCCTGGGGAGTCCAGAGGGTACTGGAAACATCATTCGCCAGGTAAGT
GGTTCCGTCAGGCCAAGATCACTGGCAAGATCAACAATGAGAAGTTGATCTTACTCTTAGACACCGGCGCCGAAGTGTCCATCGTGGACACCGCCTTTGC
TCGTAAGGTGGGGTGCTATGTCGACACGAGTCAGAGCCAGGAATGTGTGGGGATTGGCGAAAGCGTGTACATGACGGAAGGAAGGACCAGGATCAAGGTT
ACGCTGGCGAGATCGCTGGTGTATTTCTTCGATATCTGGGTTGGGGATCTATCAGGACAAGAGGCGATCCTGGGTATGGACTTCATGGTTCCGGCGGGGA
TCCGCCTCGATCTTGCGGACGGCTCTATCTGTCTCCCCGACAAAGTCAAGATCCAGCTTAGCGGACGGCGTCAGCTGTACAACGAGAATGTCCGACACGT
GTGTGTGGATCAGGGAATGCAGATCGCGATCGGGGATTCGATCGAGCTTCCGCTACAAATGAAGGTGACGGATCGAGAAAAGCTGTGGGTCACCCGTGGA
GATCGCTGGGTGCCGACCGTGGTCCGATGACGCGGCAAGATCCGATATCTCCAGGTTACCAACAACAGCGACAAAGACCTCGTCATGCATCGGAATGAAC
GGATCGCGATGTGGCTGGCTGGAGATCGGATACCCCGGATCCCAGGATATGTGTCGATCGGATCTCGTCGATACATGGAATGGCAGAATCTAGCCTTTCA
AGCCACGACAGATGACCGGCCGACGAACCAGGAGGCACCAACGGGGCCTCCAGTACCTGCCGTCGAGCGACC