Description :
From Genome Similarity Track
Location :
Scaffold_26:10433- 30740
Transcript NameFunction/comments
g4246.t1XP_009533942.1 hypothetical protein PHYSODRAFT_519308 [Phytophthora sojae
g4247.t1hypothetical protein
g4248.t1POM79013.1 Hypothetical protein PHPALM_3389 [Phytophthora palmivora var. palmivora
g4249.t1OWZ24137.1 Histidine acid phosphatase [Phytophthora megakarya
g4250.t1hypothetical protein
g4251.t1hypothetical protein
g4252.t1hypothetical protein
g4253.t1RAW30901.1 hypothetical protein PC110_g12753 [Phytophthora cactorum

Sequence
20307 bases(100 bases per row)
CAGCACCACAAGACACGCCACGTTCTGTGCGCCTTGCATGTACCACGTGAGTTCTCCGCGGGTTTGGCACCAGCACGACAGAGCTTGGGTCACTAGCAAG
TCTTCGTTGCTTGAGTCTGTTAGAGGTGACGGGAGCATCGCGAGAGGGTCGGGGACTCCATTGGGCCAATCGTCCTCCTGTCGCGAGTTCTCAATGATGG
CGTGCAGAAATGGTTGGCATTCGGAGCTGCCGTTGCTGAGTCGTACGCAGTAGCCGTCGGGTGCGAACGTGAGCTGCTGGACCGCAGTGTCGGCCTCGAG
CTCGATGACCGCCCACGAGTGCAGATGCACTGCGATGATGACCAGCATCAGGACTGCAAATTGCAGAACGACCTGGAGAACCTGCAAGCTTTGCAGCATG
ACGATACAGCGGCGCAGCAATAGCAGAACAGCGAGTTGAGAGGTGCAGCAATGATCGAGCAATGACACTTTGACACACAGAAAGTGTAGCCATATCTCCC
GCATCAAAACGACAGCCAATCAGCGTCGAGGACGCGGAATTCGAGCACTGAAATGGCTACATCTGCGTCTGGCAGCTTTCTTTCCTGTCATCACGGATTT
TGCCCAGTACTGCATACTATTAACACCAAGAGAAACAAGCTCTACGTCACTACGGACAGTGTCATTGTCATTGCCATTGTAAAAACCATAGATGAGGTTG
CTGGAGCGCTTGTCGGCCGTTTTATCCAATGATGTTGAAGGTGAGATCCGGAACCCACTTTGGTCGGGTTGCTGCTCTTCCATTTCGGAATCCTCACCGA
AGCTCTCAACGCTCAAGCGCGCTCGGTTCCAATGGCGGCGGTGACGTCTCAGTCTGGCTCGACTTCAGGGTGCGATTTCTTGTGCTTGGCGATCTTCGAT
CCCGTGTGCGCGTCCACTGGTGAGACCTTCAGCAATTCGTGCGAGTTCAATCGAACGCGATGTGTCTCTGGTGATGATTCGCTGGAGATTGTGGCACAAG
GAGCGTGCTCTAGTAGGGAGAACAGCGCTAATGGCAGTGGGAGTACCTGTCTGCTGGAGTTCTCGTGTCTGGACGTGTACACTCCGGTCTGCGGCTCGGA
CGGACGCACGTACAGCAACGAGTGCTTCTTGAAACGTGCGCACTGCTCGGACCCGACGCTGACATTGTCGTACAATGGCGAGTGTGGTGTTGCCAACAGT
TCCAGCAGTGGAGGAGGCGGTGGGGCGGTGGGCTCGACGTCTCTTGACGATTGTGAGGAGACTCCGTGCACGAAGGAGTTTCTTCCTCTGTGCGGCTCGG
ACGGCGTCACCTACGGCAATGAATGCCTCTTTCATAATGCGCAGTGCGTCAACACGTCGCTCACGCTGGCGTTCGAGGGTGAATGTGTCGCTGCGGCGGG
GTCATCGACGTCTTGGGCAGGATTGGGGCCTGCAATTGGCTCGGACGCTGCTGTCAGCTCGGAATCGGCTTCATCGGAGTCCAACACGGCCAGCAGCAGT
CGCACGGGCTTCACGCTGGTCGCCATTGTGACGGCGCTGCTAACTATGGCTACACTGTAGCTACAGGGCCGCAGATCTCGTGACACCAAGTGAATTTATG
CGGTCGTAGCAGCTCACGCACCTCGTTCGTCTCCTAAGTATCTTGCCAAACGAGCCCTTTGTTTGTTTGATCACCACACCGTTTTCTTCCTGACGCTCAG
AGCAAATGCGACCGTTCAAATTCCTTCGGACTTGTGTTCCTTGGGCATAACTGCCGTTGCAGGAAGGGCTCGAATGGCTTCTCGTCAACCTCGCAAGGGC
TCCGCGTGGGCTCCAGACTCGGCCGACGCGCTCTTCGATGATGGAATCAGCGACGATGACAGTCGCGAGCGGTGGAAGCGAGCTCTTCAAGCCCAAGACG
AGGAACAGACGCTTCTTCACCGCACCGTGGTGGCCTCGAAACGACAGAACCTCGAGCTGCAGTATGAACGAGTGAGTACGCTTTCTCCAGCCAACCTACT
CAATCGTAAGAGAGGACACGCTCCTAATGGATTCGTGTGCGTGAACTCACCAGGTGGCCAAGCAGCGAGCCTTCATTCGGCGCGAAAGACGCAAGTTGTT
GCTACAACACGCGCTGCTGGCATCTGAGCGCGAGCGATTCGACGCCTCTCGGTCATCCGACTGGTTTTGCCTTGCCGCTTTTCCTGCAGCTAGTGACCGA
CGCGTGACTGTGGATGTTGGGGGTCAACTGTTCGAGCTGTCGGCTGCTGTGGCCTTGAAAGACTCCGCTTCGCTGCTCGCTGCTTTCGTTCAGGACAAGT
CGCCGCTCACTGCCGCTGAAAGTGGCTGCTTCCGCGTGGATCGCGACTGGCGGTTGTTCCGCCACGTCCTGCGGTTCCTTCGAGATGGCATCTTGCCATC
GGGCCCGAAGCTGCTGCGGGACTTGTACGTGGAGAGCGAGTTCTGGCGCTTCGAGTCGCTCTTGAAAGCCATCGAGGCCAAGAACTTGGACCTTTGGCAG
CTTAAGCAAAGCGACGGTGGAAAAGCAGCAGCGAAAGATGCTGGAGCCAAGGATAGAGAGGGGAAGGACCCAAGTGCGTGGTGGCTGGACCCTCCAGGGT
GGTGGGGAGCAACCACAGGCAGTAAGACCAAGGAAAAGGCAGCCAAGGCGACGCTTTTGAGCACGTTCCAGAAAAGGAGAAGCTCGATGAACACCAAGCC
CAAACCGAAGGCGAAGAAGAGCGGCGAGGACGACGACGGCGAAATGGGAACGTGGTGGAAGGACTCGAAGTACAAAGGCACCGATTACATGGATATCCTC
GCGAAAGACAAGGTTAGACCTGTCGATGGCGCCTCCAAGACACCGCGTAGTCCACTGGTTACACACCACACCTGGGCGGCTTCGATGACACCTAGGAAGT
AATACACACTCTTTAGCCGTCAGCTGACCCGTTTAGGCCTTGTAGGACAGGAATTCGAGCGCCAGCGACTCGAAGTGCGAGAATGGGCAAAGCGGGTCTT
GCGTGTGGCCTGCAAAAAACACCTCCTCGTTCTCGTAGCGTGGCTTGATGAAAAACTCGTGCGACCCCTCGTCTTCGTACACCTCGAACGCCAGCATGGT
GCCGTACTGGGGCAGCTGAGCGCCCACGTCAATCTGCAACGCGCCCAGCAGCGCCACTAGCGAGTTGTCGTGCGCCGAGAAGAAGGAGAGCTTGGCTGGC
TGCTTGTTGTCCACCACCGACTTGACGAAGCCGTACACCTCTTTCACGCCGTCTTTGAACGCGCCGTAGCAAAAGTCCTTGCGATGGTACAGTCGCTGCC
ACAGCCACGTGTCGTAGGCCTCAACCTGCTCAAAGATCTTGTGGTCGACGCCCTCCGGGAACGGCCAGCCGTGCGCCTCACGACACGTGAGTGCGTCACG
TACTGCCGTCCACGACAGCGGCTGGTCGTCCGGCACCCCCAGACACTCACGGAGGTGCAGACCCAACTTGTCCATGGCCTCACGCTCGATCTTGCTCCTA
AGCTGCAGCACATCGTCGTGCACAATGAGCTCGATCTCGTTGAACACTTGCAGCGGGTGCATGGGCGCCAGCACGTTGCGCGCGTACGTGTGCACGTAGA
ACTGTGGAGCTTTCTGCTGCTCGAAGAAGCCTCTTAGGAGACACTGCACCGACTCAATGGTGCGCGGGACGCTGCTGGACAGCACGTAGATGTCGTCCAC
CTGGACGTTGTCGTCCAGGAGCGTTCCGTATCGCTCCTTCAGCGCGCGTCCTTTGCCTGTCATGTGCTCGACGCCCTTTTGCGTCAACAGGCCGTAGGGG
AACTGCGACTCCTTTGAAGGTCGGATCACTGGCGGCTGCGTGGCCTCGGCGCCTACAGGCTTGGCAGTCAGTTCCAGCAACTCCAGCTGCTCGGTTGTGG
CAACCTTGGAGGCCCAGAAGTCCTTCTCCTCCTGTGTGGCCTGCACCTTCGTTCCGATAGACGTGAGCACGGGCGTGCGATCTCCATGGCGGTGGAAGAT
GAGCACATGACGCAGTGCCAAGTCGCGACTAGTCGAAGATGTAGCCATTATCAGATGGAGAGGAGCTCGGTGGACGCTTGACAGTCTGCTGGAAGATTGC
GAAGTGAACTCTTGAGACAGCGGAGACGACTTGAATTTTATTAATATTGGTGTGGTTTACATGGACGAATCAGATGGACGCTGACATGCGTGTCATCCAA
GAGGACAATTGGGGACACGAATTGGACACTCTTACAGCGCGGCGCCTGGTTGCACCTGTAGGAAGTTACGCGCTGCTTGCTGGAACACGGCGAACGGACA
CAGCGCCGAGTGCTCGTGGCCCGCGAACGTCACTTCTGTTCCTTCGAAGAGCGCCTTGACATAGAACTCGCCCGTGACGCGGTGACGGAACAGCTCGAAG
GTCAGCATGGCGCCGTAGCCAGGGATGACGCGCGGAACTTGCAGCTGCAGCGCGTTGACGAGCGCTACGAGCGAGTTGTCGTGCGCGGAGAAGAGTGACA
GCTTGTGCTTGTAGGCGTCCTGCGTCAACAAAAGTGCAAGAGGTTGGCGAGCAGCTTTGGAGCGACACAACAGACGCAGCACTAACCTCCGTGACGCCGG
TCAGGTACGAGTAGATGCGCTGCACACCGGACTTGAAGCTCGCCCGGCAGAAGTCCGTCTTGCCGTATAGGTGATGCCACAGCCAGGCGTCGTAGTCGCA
CACTTGGGCGAAGAGCTGCTGGTCCAGTCCGTCCGGGAAGGCCAGTCCGTGCGCCTCGCGGCAGATCAGCACCTCGCGCACTTCCGCAAGAGAACAATGT
CAGTGGTTACACTCTCTCAGGCACAGTAGCAGCAGCTCAACTGACATCCTGTCCAGGCCACGAGTTTGCTGGAGCCTGCGCCGATAATCTCGCTGATCCG
TTGCGACGCGTCTGCGAACCCTGGCGGGGCGTGCAGCTGGAGCTCGTCCGCTAGCATCTTGGCCAGGTCTCGGTATAGCTCGTACGAGTGCTGAGGCGCT
AGACTGTTCGAGTCGTCGGCGTGGATCACGAGCACCTCGTGCGTCTTCTTCGTAAGGTCCTTCTGTACATGGTCCAAGAACCTCCTACTGTCGGGCAGCA
ACCCCCCACACGCCAACTTGTTGTCCGCGTCGACGTCCACAAAGAACTCGGGGAAGAGTCCGGCCAGCATACTCTGCGCCGACCGAATAGTCCTCCGGAT
GTTGGTGGACTGCACGTGCACTTGGAGGACAGGGTCCACGTCCTGCAGCAGCTTCCTGTATCTCTCTCCGAGTTGTTGACCTTTGGCGCGCATCATCTCG
ATGCCTTTCGCCGTCAACTGTCCACAAGGCCAGCGTCCGCCCTGCTGAGGCGGTGGAGGAACCTCAAATTGCTGGCCGACGCAGCTTTCTGCGTTATTTC
CAGTGCACTCGCCGTCGTGGTACTTTACTACGCGCGTACCGCTGTTGAGTGCGCCTACGACGCGCAGCTCCGCCAGGCGAGAGACCCACAAGTCCGTCTC
GTACTGCGTCATGGCCACGTTGGCGCCGACCCGGCGGCTGATGGGGGACCGATCGCCGTGGCGGAACAACACCAGCACATGCTGCAGCTCCAGCTCTTCC
TCTGCAGCCTCGGGTGGCGGCGCCATGACCAGCAGCTCTGGAAAAATGATGCGCAAGCAGTTCAACGTTCAGCAACCCTCACAACTCATAACTGTAGCCA
TCCCATAGAATACCTCCGATAATATATACTTGCTTGCTCCAATATTGCTCGCTCTCATTCTTGATGCGGGGTTCCTTGGTGCTACGGCGTGTGCTGTCCC
GCGGGTTCTCGGTATCCGCGGCGGCGCGCGCGTCCCCAGCAGCTTCGATAGACGTGCATCTATCGTTGGAGAGCTGCATCGCCCGCCGCGAGTCGTCCAG
TGCACTGGCGGCCTTCGACAAGCTGCCGAGCAGCGACCCACAGGTACTGCAGCGTCTGGCGCTGCTGGTGGCCAAGCGCGGGCAGCCGCATGAGGCTCCG
AGGGCCGCGCAGATCCTGCGGACGCTGCTGGATCAGCCGCATTTTGCGGTGGACGATGCCACGCAGCTGGCGGCCATCTACACGCTAGACGCGTGTCTGA
GACAGCGCCGGTTGGAGGACGCACTGCAACTGGTGGACGCTATGCAGCAGAAGGACGTCGTGGTGGACCTCCCCGCGGTGTACACGCTGCTAACGGCGCT
GGCGGGCGCTCACAGGGTCGACGAGGCAGTGTCCATGTTGAAGAAGGTGATGACGCAACACGACGTGCGCCCCACCGAGCAGACATTCCAGCCAGTGCTC
CTTGCACTGATGTCCCAGAGAAGATACGAGGACGTGGTGGCGCTGCTTGAGCACGGTCGAGAGAGCGACGTGGACTTTTCTCCAGAGGTGAGAGGTCAGT
GGAAGACACCTGGGGACAGTGGAGAACTGAGTGTGGTTGATTGATTGCTGCAGACGTACGACCCGCTCGTGGACCTGTCGGAGGAGCAGTACACGTCCGA
GAACGTGGAGCGACTAGGCACGTTCATGGAGTATGTGAACGACGCGCTGAGAGCGGACGGGGTGAGTGGACAGGTGAGGAGGACACATGATGGACGCTGA
CTGGTGGTGATGGTACTATTTTGCAGTATTGGGAGGACGGTGATGAGGATGGAGACGAGGGACAAGACTTTGACGATGATGACGACCTTGACGACGACGA
CTTTGATGACGAGTTCGACTAAGCGAGGTATGCGAGGCTGCGACCCTAATAGATCGATGGCTGTAGAGCCCTCGTACCGCTCGTTGTTGTGGTGTCATTG
TCTTGTATTCTTTAGACGTCCATTCCCCTGTAAATAATTCCTACGCACTACTGGATCGCATCGACTACACTTGCTCGGCTGCTGCCCCGAAGCTCTTCAA
CTAGCTGCTGCGCAGTCGGCCGGCTGGCTGGATCAAGGGCCAAGCACGCTGAGCCAACACGGCGTATACGCGGAGCACAGTCGGCTGAAAAGCTCGGCTG
CAATGTGCCAGACACGACATCCTGCAAGATTTGCACGGGCTTCAACTTGCTTCCGCCCTCTGTCACAGCGTCGAAGTAGGGGATCCGTCCCGTGTCCAGC
TCGGACAACACCACGCCGAACGAATAAATATCTGCCTGCTCCGTGTAGCGGCTGCCCTCCAGGACTTCAGGGGCCGTCCAGTACGGCGTGCCGATGCCTG
CTGTCATCGTGAGGTCGATGCGCCCGCGACTGACACCAAAGTCGATCAGCTTGGGCTCCAGCATGTCTGTCAGCAGGATGTTGTTGGACTTGAGGTCTCG
GTGGATCAAAGGAGGTGAGTGGCCGTGCAGGTAGTCCAGAGCTTGCGCGATGCCGACGGCCATGTGGATCTTGTCTCTCGCCCACGACAGCAAGTCTGCG
TTCTGGTGCAGATAGCTTTGCAGACTCCCGTTCGGAACGAACTCGAGCACCATGACCAAGTTGTTGAGGTTGTTCCAAGCCACGCCGATGAACTCGACGA
TGTGAGGGTGTGTGAGACTGGCAGTCAGCTCGATCTCTTCGGCGAACGCTTGCACGTTCCCAGCCTTCTGGTCTTTGCTCTGCAGTAGTCTCTTGGCAGC
TACCTTTCGTCCGTTGTAGGCGCTGAGCCAGACTTCCCCTGAACTTCCCTTCGACAGCGTCGTCTGAAGCATGAGACTTTCGTACGGAAGACGCTTCCCC
TGAAGGTGGTGACTGCCCAGCAGAATCTTGAGCGTCCTACAGGACCCAGCGCTCTCGTAGCCCTCCAAGTGACTTGACAGGAAAGTGCTTTGCGTCGTCA
TGATGGTGGGTCGGAGTGCTGGCTCTGCCATTTCTGCAGCGTAGTTGGGTACTGGTATCGTGCTTCCACTCAAATACAGCGGAGAGCTGCTACAGAGATC
ACCCGTAGTCGACATGGTCTCCTCGATCTTGCCCTTCGCTCTCCGTCTCCAGCAAACCCAGCCAAGGCCGATGGCTGCGACCAAGGCAACAGCACCCACG
ATGATCGGGAGCAAGAGCAGTGTATCGAAGCCTGAATCTGCAGCAAACTCTTCCTGCAACCAGGCCGTGACCCACGCGCTTCCTGTGGGCGTCGTCATCG
CGGCCATCTCCTCGTCCGAGAACTCGTCTCTCCTGTGGCACGGAACTGTCATGGCCGTGTACTTGTCGTCCACCGGACACACGTTCCAAGCGGGGTCCTC
GGCACTGGACGCCGTGTGAACGGCGTAGACGCTGTACGCAGCTTTCGTGACCGGGTCCTCCCACGAGTGATCTCGCAGCCGAATGTGCGGAGTCATGCCC
GAGTCGCCACCTCTCGACCACATCGAGCCCATGTAGCTGCTAGCAGCCGAGTCCACGAAAGTATCCGCTACACACCTCGACACGTTGAGCATTTGCTCGC
CTGAACAAATGAGGGTGTAGAACGCCATCTCGTCGTTCGGCTGCGAGCAGTTCTTGAAAGTGCATCCGACGTCGCTGACCTCCTCCTTCGGGACGGCGAT
GTCGGCCATGGTGTAGTCGCCCTTGGTCCAGATCTGCACGGGGTCGTTGGACGGCGAGATGGCGAACCCTGAGTCCCAGAGCACCGCACGCTGAACGAGT
CCGGGCAACTCGCTGAGAGCGACGTTGAAGCGGTTGAGGCGCGTGCTCACGGCAGTTGGGACCGAGTTGAGCGCGACTGCATCCTCCGAATCGCCAGCTT
TGTGCCGGATGTAGAGCTGCTGTGCAATGTCGGAGTTGGTTCCGTCGAAGACGAACGAGCTGGTTGCTGAGGTCGCCTCGAGACTGCGCAGACTTATGGT
GTGACCATGCGCCATGCTCAAGAGGATTGCAAGAAATACTGCGAGCGCAGTCATGCGACTCGGTTGGCGATTCTCCGAATGCTTGAGCAAAGGCACCATG
CCGACTTGGAATCGGCTGGTGGCTGCGATTTGCATCGAGTCAGAACTCCCAGGTGGGGTCTGCACATCTGCAGGTCAAGTCACTCGATGTGTACGTCAAA
TGGACACGCGTTGCATGACCAGCAGCACTTTGTCGAGGCGTTGCAATGTTCAAGAGCGATCAGTGGTCGCTTCCGCCGATCACGCCTGTGGTGGCGAATC
CTTGAGCTTCGGACTTCGAAGTACTACATGTATACTACATTCCCACAGTACAGCCCGTAAAGATAGGAATGTCAAAGGGAGGGTAGATGCACGGAGCCAG
CTGCGAGAGTTGCTCATAGGAAACGGATACGATGTCAACAATGCTGAATGCCAAGTTACTACTATTAAATACGCTAGATGGGCTGTCTGCTACAGACTCT
AGAAGGAATATACCAGCTCGGTACTGTTGCCTTCGAGCTCCTCGACAAGTTGGCAAGCAGTTGGCCGACTCGACGGATCGAAAGCTAAACACGCGAGACC
GACCCGTTGTATCCGCGGCGGGCAGTCTCGAGAGAAACTCGGTCGCAACATTCCAGCCATCACGTCCTGCAGGATCTGGAACGACTTCGCTTTGCCTCCA
CCTTCCGTGGCTGCGTCGTAGTACGGGATTCTGCCCGTGTCCAGTTCCGAGAGCACCACACCGAACGAGTAAATGTCGGCCTGCACCGTATACCGCTTGC
CTTCCAGGATCTCCGGTGCTGTCCAGTACGGCGTACCCACTCCAGCCGTCATGGTGAGATCTCCAAGCCCGCGACTTACGCCAAAGTCGATGAGCTTGGG
CTCCAGCCTGTCCGTGAGCAGGATATTGTTCGACTTGAGATCGCGATGGATGATCGCAGGCACGCGAGTGTGTAGATATTGCAGAGCTTGAGCAACGCCA
ATGGCCATGTGGATCTTGTCCCGCGCCCAGGACAGCAAGTCGATGTTCTTCTGCAGATACGTCTGCAGGTTCCCCGCGGGGGAGAACTCGATCACCATGG
CTAGATTGTTGAGACTATTCCACGCCACGCCGATGAATTCCACGATGTTCGGGTGGACGAGACTTGCACTGAGCTCGATCTCTTCAGCGAAAGCCTGGAC
ATTATCGGCTTTCTGGTTCGACTGCAGCAGCCTCTTCACCGCGACTTGTTGTTCGTTGTACAGGCACAGCCAGACCTCACCCGACGCTCCCTTTGATATG
GTCTTTTGAAACGTGAGGCTCTCGTACGGAATGCGTTTTCCATAGAGGTGGTAGCTATCGAGGAGGATCTTGAGAGTGTTGTTCGAGCCTGCGCTTTCGA
AGTCTCCCGAGTAACTGAAGATGGACGACTGACCCGTGGGTCGGGTAGACGCCGTCGTGCCTCGCAGTGCCAGCCCTAGGTCGGGTGTTCCTCCACCATG
ATACCCAGGAGAAGGGACGCTAAGGTCACAAATAGTAGGCGCTGTATACTCCTCCTTACGCATTGAGCGATGCCGCCAGCAGTACCAACCTAATCCGATC
GCCCCAATCAGCACAAGAGTGCCAGCAATGAGAAGGATCAGCATCAGCGTGTCGACACCGGTATCTACAGCGAACTCGTCCTCCAGCCACGCCGTGACCC
AGGCACTTCCTGCAGGAGTCGTCAGCGCAGCAATCTCGTTGTCGGTATATTCACTCCGTCTGTGGCAAGGAATTGACAACGACCCGTACCCATTGCTGGC
AGGACACTCGTTCCATGCTACGTCCTCTGCTCCAGAAACCGTGTGAACAGCGTAGACAGTAAACGTGTCGTTCGAGACGGGGTCAGTCCACGTGTGATCT
CTCAGTCGAATCATCGGAGCCATGTCGGGGTCCCCACCTCGAGACCACATCGCGCCCATGAAGTTAAGTGCTCCCGTATCTTGAAATGTATCTACCACGC
AGCGAGACACGCTCAGCATTTGGTCACCGGAACAAATGAGCGTGTAGTAGGCTGTCTCGTCGTCCGGCTGCGAGCAGTTCTTGAAAGTGCACTTGGCGTC
TGCGACATCATCTTTCGGGACGGCAATTTCTGCCATGGTGTGGTCGCCCTTCGTCCAGATCTGCACCGCATCGTTCCCAGGTGAAATGCCAAAGCCTGTG
TCCCAGAGCACCGCTCGCTGGACAAGCCCCGGCAGGTCGTTGAAGACGATATTGAATGGGTCGAGTCGGCCGGCCACAGCTCTCGGAATCGAGTTCAGCT
TGACTTGGTCGTCGGTGTCACCAGCGCTGTGGCGGACGTAGAGCTGCCGCGCAATGTCGGAATTCGTGCCATCGAAGACGAACGAGTCGTCCGACGGCAG
TGAAGCGGACGAAGACGCCGCCACGTTCCGGAACGCCATGGATTGAGATTGGACCACGATAGACACGATTGCAAAATAGACCACAGGAGCAGCATGCGCA
CGTAGGACGAAATGCGGTAACGGACCTCCCAGAATGGACCGACCCAGGTTCACAGTGAAATGCCGTCCAGACAATGGCCAGCTTGGAGCTGAGCGGCAAA
CGGCGTCTGCAAGGTACAGTGAAATCAACTCCATGTCACCAGCTACTGAAAGTGCCTTTCCCATTGCTGAGCGGCAGCCTGTCCCGAAGCGCTTGAGTAA
CGTTGCACCTCACCATGCCAGTATTAGTTCTTTTGCCTGCCTTCAAGCTCATCCACCAGCTCCTGTGCCGTCGGGCGACTCGATGGGTCCAACGACAAGC
ACGCCGTGCTAATTCGCTGGATTCTCGCCGGACAATCGCCGGCGAAGCTCGGACGCAGCGTGCCTGACATGACCTCGTTCAAGATCCGGAAGGGCTTCAG
CTTGGTTCCGTCTTCGGTCACTGCGTCGTGGTAGGGAATCTTGCCAGTGTCCAGCTCCGAGAGTACGACGCCGAACGAGTAAATGTCGGCCTGCTCCGTG
TAGTGCTCGCCTTCCAAGACCTCGGGCGCTATCCAGTACGGCGTGCCAATACCTCCGGTCATGGTCTGCTCAACGCGTCCGCGACTGACTCCAAAGTCGA
TGATCTTGGGCTCTAGCGCGTCCGTCAACAGGATGTTGCTCGACTTGACGTCTCGATGGATCAGAGGAGGTGTGCGATCGTGCAAGTACTTCAGAGCGTT
GGCGATTCCGATGGCGATGTGGATTTTATCTCTCGCCCACGATAGTTGGTCTGCGTTCTTCTCGAGATAATTCTGAAGATTCCCCATCGGCAGGTACTCG
AGCACCAAGACCAAGTTGTCGAGAGTGTTCCAAGCTACACCGACGAATCCAACGATGTGCGGGTGAATTAGCGTGGCTGAAAGCTCAATTTCCTCTGCGA
AAGCGTGCACGGTTTCAGCTTGCTCCTTCTTCGCGGAAAGCAGTCGCTTGGCAGCCACGTGTTGGCCATTGTACTCGCAGATCCACACCTCTCCTGACGC
CCCCTTGGACAGGGCGTTCTCAAACACCAAGAGCTCGTACGGAATGCGTTTTCCGTGGAGATGGTCACTGCCCAGGAGGATCTGGAGCGCCTTGCTCGAG
CCTGCACTCTCGTAGTCGAGGCTGGAAATGCTTACGCCGTGAAGTATCAGCGAGTCCATGTCTATGGGCGTTAGCGCTGACCCGTGCGTGGTGTCTCCGA
GGCGGCTTCCAGTGAGATTAGTGCTGGTAGACGGGAGTAGCTTTTCCTGAAGCTTGGTTCGTCGTCCCCGGTAGAACCAAGCGACTCCAATCGCCACAAA
GACTCCTAGGAGGATCGGGAGCAGCATGAGCTTGTTGAATCCGGAGTCCTCGGCGAACTCGTCTTCCAGCCACGTCGTGACCCAAGCGCTTCCTTCCGGC
ACCGTCGTGTTCGCAGCCATGTACTCGTCCGAGAACTGGTCTCTTCTGTGGCACGGCACACTCAGCGGTGAGCCATACCCCTTCGGAAGGCATTCACCCC
AAGGTGCTTCGTCTCGACTGGCTACCGTGTGCACCACGTAGACCGAAAAGAAGGTGTCCCCGCCAAACACGGCGATGTTTTCCGTCCACGTGTGGTCTCT
CAGCTCAATCTCCGGGACGAGATCGGGGTCGCCGCCTGCTGCCCACATATTGCCCAAGTAATTGGTGGACCCAGTGTCGTTGAAGACGTCGATGACACAG
TGAGAAGTGTTGAGCATCTGATAGCCGGTGCAGGTGAAACTGTAGTAGGTTTGCTCTCCGTTCGGCTGCGTGCAGTTGGTGGTCTTGCACTGCACGTTGA
AGACCTCGTACATTTGCACGTTGATGCTGGCCATGGTGCGGTCCTTCTTGGGGTAGATCTGCACCGGGAGATTGCCCGCTGCGATGGCGAATCCCGTGTC
CCACAGCACGGCACGCTGGACGAGTCCGGGGAGTGAGGCAAAGTCAATGTTGAGCGGGTCTAGTCGCTTGATGACGGCAGGGGGGACCGACGTGAGCTCA
ATTTGGTCGCCGGAGTCGCCAGCGTTGTGGCGGATGTAGAGCTGCCGGGCGATGTCGGAGTTGGTCCCATTGAAGACGAACGACGAGTTGGTCCTATCGA
CGGAAGAGGAAGTTTCGTCGAGGCTCTCGAGGGTGATCGTCCCGCCTTGCTCCAGGCTCCGGGTCATCTTCACCGCAGACAGATCTCGGAATGGCGACCT
TTAAGCGTGGATAATAAAGAGAAAGTGAGCCCAATAGGTTGACTGCTGGTGGTGTAGGTTCGGATCGGGTGTCTTTGACGTCGAGGCCTCCACATGATGA
ATAGATGAGGCTCAATTAGTACCCTACTGGCGCGAATGCTCGCGTACTCTCAATGCCGATGCTGCTACTCAGACTTTCCCTGCCTCCAAGTTCATCTACC
AGCTCCTGCGCGGTCGGTCGGCTTGCTGGGTCAAGGGACAAGCACGCCGTGCCAATGCGTCGAATTCTTGGCGGAAACTCGTCGGATAAACTCGGACGCA
ACGAACCGGACATGACCTCGTTCAAGACTTGGAACGGCTTCATCTTGGTGCCGTCTGCGGTCACAGCGTCAAAGTACGGGATCTTCCCCGTGTCCAACTC
GGATAACACGACGCCGAACGAGTAAATGTCGGTCTTCTCCGTGTAGCGATTCCCTTCCAAGACTTCAGGAGCTACCCAGTACGGCGTCCCGACTCCAGCC
GTCATCGTGAGGTCGATCAGTCCGCGACTTACGCCAAAGTCAATCAGCTTGGGCTCAAGGTTCCTCGACAATAAAATGTTGTTGGACTTGAGGTCGCGGT
GGATAATCGCTGGCGTTCGCGAGTGCAGATACTCCAGCGCTTCCGCGATCCCAGTAGCCATGTGGATTTTATCTCTGGCCCACGACAGCAGAACCGCGTT
CTTGTGCAGATAATTCTTGAGGTTCCCCATGGGGACGTACTCCAGCACCATTACCGGGTTGTTGAGGCTGTTCCACGCCACTCCGATGAATCTCACGATG
TTTGGGTGGACGAGACTAGCGGTCAGCTCGATCTCTTGAGCAAACGCTTGCACGTCCTCCGCCTTTTGTTCTTTGGTGTGAAGAAGCTTCTTGACGGCAA
CTTGGCCTCCGCCGTACTCGCACAGCCAGACTTCTCCTGATCCTCCTTTTGAGATCTCGCTCTTGAACGTGAGTCTGTCGTACGGGAGCCGATTTCCCTG
GAGGTGCTGGCTGTACAGAAGAATCCTGGACGTTTGGTTTGAGTCAGCACTCTCGTAGTCGGAGAGGCTGGGGACACAGCTTGAAGGTTGGCTGCTCGCG
AGCGTGGGACGGATTGCCAGCTCACGTGAATTTTCACCAACGTAGTGAGCTGAAACGTCATCAAAGCCACAAGACGAGGACCGCTCCTCCTTCATCGTTG
CTCTCCGATTCCAGTAGAACCAGCCAACGCCAATCACTGCGAGGGAGCCCAAGATGATCGGAACCAGCAAGAGCTCGTTGAAACCAGAGCTCTCTGCTGC
GAATTCATCTTCCAACCACGTTGTCACCCAGGCGCTCCCAGCGGGTGTGGTCATAGCAGCCATCTCTCCATCCGTGAACTCGTCTCTCCTGTGGCAAGGC
ACTATCAGCGACGAGTAGCCATCACTTGCAGGGCACTGGCTCCACGTCGGGTCATCGGCACTCGAGCTCGTGTGAACAGCGTACACACTGTACGAAATGC
CCGTGGTCGGCTCTGTCCACGAGTGATCTCGCAGCCGAACGTGTGGAGTCATGGCGGAGTCACCCCCAGTCGACCACATGACGCCCAAGAAGTCGGTCGC
TCCAGAGTCTACAAACGTATCAGCCACACAGCGTGACACATTGAGGACTTGACTGCCTGAACAATATTGGATCAAGTAAGCTGGAACATCGTTCGCCTGC
GGACACTCTAACGTCGTGCAGTTGACTTGGGTGATATCGTCTTGCGGTACAGCGATACTTGCCATGGTATAGTCCTTCATTGTCCAGATCTGGACGGCGT
CATTTCCTGGAGAAACAGCGAAGCCGGTGTCCCAGAGCACCGCACGCTGGACGAGTCCGGGTAAATCTCCGAAATCAATCTCCAACGGCTTGAGTCTGTC
GGTCACTGCCGTTGGAATCGAACTCAGCGTGACTGCATCTCCGGTACAGCCTGCTTGGTGACGAAGGAAAAGCTGCTGTGCGATGTCGGAATTGGTGCCG
TCGAAGACGAACGAAGCGTCCGAAGCGAGAGACGACGACGAAGTTTCGACGAGGCTTCGGAAGGTGATTGTTTGTGCCTCGACCACGCTCGACACGATTG
CCGAGGCCACTGCGAGAAGGTCGACACGCATAGTGTGTGAGTCAGGCAGCGAGTGCCGGAGTGATGAACATGCGGAATGCCAAGCCTAGGTCGTTACGGC
GATCTCACTTGCCGTCTGGACGGATCAGGGTATCAACAATAGCAGGGCTATTGCACTTCGTGCCGTGGAGCGGGAAGCGCGTACAGGTGTTCCGAGGCAT
CTGGAGAGGTGCTACTGAGACGCTAGATAGTAAAGGCAGGAAATACCCACCCAATTACCTGATGGAACTCGTGATAAGGCACAAGTGTCCATGTGGTCTC
TGAACTACAGCGGTGAGGAGTGAGTGGTGACGTCTGTTCAAAACCTTTAGAATTATTCACAGAGCGAACACCGTTTTCAGAGGAACTCAGTCGCAAGTTG
CAGGTTGTATAACACGTGGAGCGGCTTCATCTTGCCGCGAGCTTCTGGAGCCTAGCCATACTGTTCTGAGTCGTAGCACCCGCACGATACTCTTGAGCTC
TGATAACACCGCCACCAACGAATAAATATCCGCTTTGATTGGTACTGCTTGCATTGTAGGATTTCTGGATGCCGTTCCCACTCTGAGCATCAGCTCCAGC
TTACCTGTCAGCAAAATACTGCTCAACAGACACAGCGAAGCTTTCCACATTGTACATCAGATCTGTATTTGCATGCTAGGATATCATCTAGCCGCTAGAG
AGTATAAACTCGCCGGCGCGCATCCGCCCGTAGCATGTGGGTAAGCTCGGCTGCTGTTGGACGCAGGTCTGGGTCGTGCTGCAAGCACTGCATGCCCACT
GAGCGAATCCACCGAGGACACTCTTCTGAAAACGAAGGGCTCAAGCTGCCATCCAGTACCCAGTGCAAAACCTGAAAAGGCTTCGGCTTCTTGCCCTCGT
CCGTAACAACGTCGGAGAAGGGCATCTTGCACGTATCCAGCTCGGACAGCACCACGCCGAAGGAGTAGATATCGGCTTGCTCCGTGTACCGCTTGCCTTC
TAAAATCTCGGGTGCGATCCAGTACGGGGTGCCCACCCCCGCCGTCATAAAGCCGTCCTTCTGTGAGCGACTCACGCCAAAGTCGATGATCTTGGTCTGT
AGCGTCTCCGTGAGCAAAATGTTCTTGGATTTGAGGTCGCGATGGATTATCGGCGGCTCTCGGCTGTGCATGTACTGGAGCGCGCGTGTGATCCCCACAG
TCATGCGGATTTTGTCTCTGGACCACGATAACAAGCGCCCGCTCTCTGCCAAGAACCTCCTCAAGTCCCCCATCGGACAGTACTCCATCACCATCCCCAC
ATTGTCGAGGCTGCTCCATGCCACCCCAATGAAAGATACGATGTGGGGGTGGCTCAAACTCGCACTCAGCACGATCTCGTCCACGAACTCCGTCACGTCC
TTCAGCGTGTGCTCGTTGGTGCGAAGCAGCTGCTTGACTGCAACCTGCTGGTTCCCAAACTGGGCGAGCCACACTTCCCCCGATGCCCCACTGGACAGCG
TCGCCTTGAAGTGGAGACTCTGGGCCGGAACACGCTTCCCCATGAGCTCTGGGCACTCCAGCAAAGTCGGCAGGATCGTACTCACTTCGTAATTTCTCGG
TGGTACACGAAAGGTTTCGTGAATTCCAAACGGATTGGTGTTCATCTCTATCGACAGCGTGTGCCAGCCTTCAGAGCGCTGCGATCGCTCGTCGTACGAT
TCGTACGCCCCCGATCTCGAGAGATCCTGCAAGCTGCTTGGCGATTCTACCAACAGATCACGTGGTTTCTGCCTGTTCCGACGATAGCAGAGCCCGACCC
AGAACATCGCAGCCACGATCAACGCTCCGATCGCCAAAGGGATCACTAAATACACATTGAACTGTGGACGTTCGTACTGCGGTGAAGGTGGAGCAGCCCC
CGGGTCCAGTCGTCGTAAAGCATTTGCTGCCTCGATGAACATATTTTCACGTCCAAGCACCAGGACGAGACCCACGAGCTCTTGCGTCCGCATGAGGAGT
CCTTTTCACGAATGTCGAGATCTCTTTCGCCACCAACGTTCAAGACCTCAGGCAGAGTGACATTGGAGCTAGAATGTGTCACCTTCAGCGTTAGAAGATG
CCCGTTGCATCCTCCGACTTGATGCTCGCCACACGTTTCGACCAGGAGGTCCTGAGACGACAAACTCGACGTGGTACAGGAAGGGAACTCGCTGTGTTGT
AACAGAAAAATGAACCTATTTCGCCGGGAGGGTATTTTACCCGACTAGAGCATCCCCTTGTATACTTTAACCCGGTGTGCTAAACATTTGAAACTGATAT
TTATATCATTATCCGGACATGTATAGCTCATTGAATAAAACGTACGGATCGGGTATAATAGTAAGACTATTGTGCACATCCAATCGGGTGAAATAACGGG
CGGACCTCTTGGTGATCGACAGCGAGTTGTCGAATGGCAGAGGCCGGCGTAGTTGTCCCTAGACAACATCAGAGTTTATGCATGCATTTCAAAGCCTTTG
GCAGCGCCTTGATCCTCGACACCCAGTTCATTTGCGACCATGGAACGCGAACAACCCACCGCCGAAAAGGGCTCCGTGGCACTTCGAACCTGGTAATACA
AAGCTGGCAACCGCCTCTTCGAGGGCCCAGTGATACTGCACCTCGAGCAGGAGAATGTGCGCGGGATTAAAAGACCAAAGGGTTCAGTATCAGCATCAGA
ATTCCGCTGAACCCACAGCAAGGGGCGGTCTCTGCTGATCTCGTGGCCATTCCTCAACTCGCCGCGGACTGGGAACGTCGAGCATCATGTCGAGTTCGAG
CGAGTCCATGGCTTTCGACGGCTCGAGCTCCGACCTGGCGCGTCAACTGTACTACCGAGCCAAAGCCCAGGACCAAGTCGAGCAACTCGCACTCAACGCC
ATCCCAGCGGGTCTTCAGACGCGGCTAGACAAGCTGCAACTGGACTGGGACAAACTGCCAGGCATCGCCCAACGCGCGCTGCTCTGGGACTCGGGCTTCG
CTGTCAGCGCCGACGGTGACGCCATCCAGATCTGGACACTGGGGGACCACACCATGTCCACGTTGGCACTTACGGCCGACGAGTACGAAGCAGCCGGCTG
TGTCTTCGGCAACTGCACGGAACCCGACGGCACTGAGATCCACATCAACTACCACTGCAACGGGGCTCAGATGAACAGGGCGGCCAAGTGCCTCGCGCAA
GAGTTCAAGGACGACGTCTCGTACAATGCAGCCATGTGGGCTATTGGGGGCCGCGCCTCCATGGTGCCAAAGCCCCGAGTGGCCAAACACGACTGGGTCG
ATGGAGAGCACTACGTTGTCATGGCAGTGCACACCCTCAGCTCCGATCAGGACGAACCGGGGTACGATTCGTGTCCTACCACAAGCAGTGAAAGTGCGGG
GTACGGCTCGGTCGTCTTCCCTTGCCAAACGACAGCCAACTTCACGTCGGACTTGGAGAAAAAGACGGTCGTAGGCAGTGACTGGGTCTCCAACTGGCTG
GTGGAGGACTACCCGGACGCAGCGGTGGAAGACTCCAATGGGTTCAACAAACTGCTGTTGGTTCCGATCGTCCTGGGGGCGTTGGTGGTCGTGGCGCTGG
TTGCTTTGGGCTTTTACTGCAAGAGGAAGAGGCAGCAGCGAGCTCGGATGGAGTTTGAGGAGAGCACAGCCGACGTCGGCCAGACGCCCTACCTCGCGCC
AACTCCAGGCGACAAGAACTTTGACCAACGAGATACCAACGCCCGCCCCACCTTGGCTGTGAGTGAAGACCTGACGACTTCCACGTACACCGGGGCCGAC
CACACCATTCAGTTCCCAGTCGGATACGGAGGTGACTACGTGTCTGGCGGATCCAACACAACGTTGAAGATTCTTCTGACCAGCGAGCACCTTGTTGGCA
AACGGATCCCTCTCGAGAACTTGACTTTTGAAAAGGCCCTGTCGAAAGGGGCGTCTGGAGAGGTCTGGGTCTGCGAGTACGCGGGACAGAAAGTTGCAGC
CAAGAGGTTGCTGCAGACGAAGGAAGCCAAGGCGGAAGACGTCCATGAATTTGCTCAGGAGATCGAGTTGAACGCCAGCTTGGACCACCCCAACGTCGGC
GCGTTCATCGGCGTGGCCTGGAGCAGTCTCAACAACTTGTCCATGGTGATCGAGTACTTCCCGCTCGGAGATCTGCAGCGGTATCTGAAGAGGAACGCAG
ATCTGCTGTCGTGGGCGAGGGATAAAATCCACATGGCCATCGGAGTGGCTAGCGCGCTCGAGTATCTCCACAGTCGCTCGCCTCCAATCATCCACCGCGA
TCTCAAGTCCAAGAACATTTTGCTCACCCGACAGTTAGAGGCCAAGGTGATCGACTTTGGCGTGAGTCGCGGACGTCTGGACAACACCATGACGGCGGGA
GTGGGCACTCCGTTCTGGACGGCGCCGGAGATTCTAGAGGGGAAACGATACTCGGAACAAGCCGACATTTACTCCTTCGGCGTCGTGCTGTCTGAGCTGG
ACACGTGCAAGATCCCGTTCCACGACTGCATTTCGAGCAAGGGGAAGAAGGCCAAGCCGTTCCACATCCTGAAGGAAGTCATGGCGGGGACCTTGCGCCC
GAGCTTCTCAGCAGATTGTCCACCTCGAATCCGTCGCGTTGGTGTAGCGTGCTGCCAGCAAGACCCAGCACGACGACCAACTGCCGCTGTGCTGGTAGCG
ATGCTGC