Description :
From Genome Similarity Track
Location :
Scaffold_3:1043007- 1047118
Transcript NameFunction/comments
Physo_559937carbonic anhydrase, putative
Physo_559939protein kinase, putative

Sequence
4111 bases(100 bases per row)
GACGACACTGATAAGAATCAGTACATATTCATATATGGTACGGATGGACGAAGTGAAGTAAAGAGAACGATGAAGGCGGACTGTACAATAGCATACATTT
TCTACAAGCTGCAAACAGATCTCAAGCAAGTAAAATTGTAGATACAAGATATCAACCGACAATGCTTCACAAAATTAAAATGCGAGCAGACCAATTTCCG
GGCAGACGCAGGTGATGACCGTAGCTAATAAGAAAAAACAGTTAATAAAAATAAAATTAAAAAGGATTTTATACTAAAACCTCCTAACCCAGCCTTCGCG
GGGCCTTAGGTATTGTATCAAACGTTCTTATACTACTGGATGTCGTTGGTAGGTATGAGCTGGATTTATCACCAGACGTTTCGATCGCTCATTAACTCTG
AGCGAATAACTCGTTGGTAGGGGTTCGTCCTCATGGCACGTTCCCTCTTCACTCCGCGGCGCGATAGCTAGTCCGCCTCCCGCCAGGCAGAGGATTTTTT
TCGCCGAGCAGCCTGAGTTGGTGATGGTGTAAGGGATTATGGTTCATCCTCAGCTTTTTGTAAAAGACTGCACCACCAGCCGGTACCATAATTGTGGTAC
CATATCATGTACCATGGTATACCTTACGACTGGAATATCCTCGGCGAAGCGACGTTGGGATCCGATCTTGGTAATGGACGGCTGAGCATGACGCTATAGC
AAGCGTCGGCGGCGCTCTGGGGCGTCTGTGAGCCGTCAATTGCTGCGTCGATGGCATTTTCAGCCTCGGATCTTGGCTGCGGTCTCTCTGTGTGGAGATC
CTGGCTTTGAAAGCTACCGCTGCGAGTCATTCTTGAATTTACAGCTTGTTTAGCACCTCGATTCCGTGAAGACGTTCGAACCAAGGCAAAGAATGCTCGT
TGCTGTGTCGCGTGTCGTGCTCTTGGCTGCAGCTCTGGTGGCCGCGGGTCAGGCGTCGACGGAGAAGTGGGGCTACAAGGAGTCGACCGAAGAGGAGCTC
GGCCCCGCTGACTGGAAGGAGTCGTACCCGGCGTGCGGAGGAACTCACCAGTCGCCGATCAACATCCCGGTCCGTGATCTCTCGCACAACGACTGGGGCA
TGTTCCACGCCCCGCTCACGTACGGAGGCGACTGCAGCAAGTTCAAGCTCAAGAAGCTCGAGGACCTGTACAAGTGGCAGATTGACGGAGACGAGCGTGA
GTAGAAGTCGATTCGGCGAGTTGTGCTTACATTCTACGTCTAACTGTGGTGTTGTTGCTGCAGACTGCACGGTCAAGTCCATCAACTTCGACGAGCGCGA
GTACTCGCTGGCCCAGTTCCACATGCACGCGACGTCGGAGCATGCGCTGGACAACTACCACTACGACGCCGAGATCCACTTTGTCCACAAGAACAGCGAC
ACTGACAATCTCCTGGTCACGGGCGTGTTCCTCAGCGCCGAGCCGAACGTGGAGGAGAACGCCTTCATCAAGAACCTCATGAACGACCTGGAGACGAGCA
GCGACGACTTCGACGTGAAGGAGAGTGGCATCAACTACGCGGACCTGCTCAACGGCCTCGTCGCCAAGAGCCACCTCTTCAACTACAACGGCAGCCTCAC
CACGCCTCCGTGCAGTGAGGTGGTCGACTGGTGGGTGCTCAACAACCCCATCCTCATCACGTACGACGAGCTGCGCACGATCAAGAACTTGTACGCGGAC
CTGCCGGCCACGAACGACGCCGCGGACAACCGCCCCACGCAGCCGATGAACGACCGCCAGGTCAAGTACTACTAAACTAGGAGCTGTACCTCCTGGTTGC
CATGTCCCTCGAATCAAGCGACAATGGCCATGTGATCGTGTCCACAGTATTATGTGAGCAGCTGAGCTAACAAAAAGATAACAAGTTGATGCATATTAGC
TTCGGTTATCGTTTTCACTGTCGTCGTCAACCTGCGCAACAGCACAATACACTACATGTAAACACTGGGTCGTAGCTTGCTTGCTAGATATCTTACTCAA
TGGTTTAGTTCTTCTCCTCTCCTTCCTCCTTCCCTGTTCTACGCTGGCACATCAAAAACGCGGCCTTGACCATTCACTAAATCTGTCTCTTGCTTCACCT
TCCTCCCACCTACAAGTTGTACGGGTCCGTGTACGAGAAGCCCTGGAAGACGTGGCTCTTGCCGATCGGGGCATCGGAGACCACCGAGTCGATCACTTCC
TGTCGCTTGAAGAACTCGGGCACGTTGTTCACTTCGCCGTCCGACTTGACCACAGGCCTGAAGGGCACGGGCACGTCCCGCTTGTACAGTTTCTCCCAAT
CCACAGTGCTGAAGAACGGGTGGTCCATGATCTCCTGCGCGCCGCACGGACCGGAGCCGAGTCGCTTGGCCGGGTTGCGGCAGATCAAGCCACGCAGCAA
GGAGCGCGCGTCGTCGGAAAACTCGGACGGGAACCGCAGCGGGAGCTTCACAATGTTCTGGAAGTTGCGCTTGCGGTTCGCGTGGTAGAACGGCGTGTAG
CCCGCCAGCATCTCGAAGATGAGGACGCCCAGCGACCAGTAGTCCACTGCCTTGCCGTACGGCACGCGACGAATGAGCTCGGGGGCGATGTACTCAGGTG
TACCGCAGAAGGTCTGCATACCGTCCTTGCTGTCGAAGTGGTCGTGTGACAGACCGAAGTCCGTCAGGGCGATGAATCCCTGGTCGTCTAGCAGAATATT
CTCCGGTTTGAGATCACGGTACACGATGTTGTACGTGTGCAGGTGCGAGATGGCCAGCACGAGCTGCGCGGCGTAGAAGCGAGTGCGAACTTCATCAAAG
TGCATCGCCCGACGCAGATGAAAGTGCAGCGTGCCGCCATTGTAGAAGTCCATCACGAAGTACAGCTTCGCCTCGTTCTGGAAGGCGTACCGCAACTTCA
CCATGAACGGGTGGTCCACGCCCTGCAGAATACGACGCTCCGTCTTGGTGTGCTCGACCTGGTTTTTGGCAAACACAGCGGCCTTCTTGATCACCTTCAT
GGCGTACACCTTACCACCTTCACTGCCTGAAGCTCCTGCGATCTGTTGCGGGGTCATTCCCATGGACATCATCGTCCGCGGGCTTAATAACCGCGCTCCC
TTCTGTTGCTGCTGTTGCGGCAGCTTTCTTCGGACCAGCATCACCTTACCAAAGGCACCACGGCCAACCACCCGAAGCAGGTCGAAGTCATCAATCGTCA
ACGAGTCGTACTCGCGCGGCTTCAGCTCACGAGAAGCATTTCCAGCTGCGCCTCCCAACACAGCGTCATACACGGATTCCTTCCGCCCGCGCGCTTGCTG
GTCTTGAGGAGGCCGTCCACTATCAGCGCCATGGCCTCCGTGGCCGTGCCCTCCGCGGTCGGTATGACCACTACGTCCACCGTGGGCAGCTGGCTCCTCG
TGCCCCTGCTGTACTCGAGCCTGCTGCTGCTCCTCCAATAGCGTATTCAACCGCAATTCACGCGCTGCTCGGCGCTGGAACTCGTAAGGCGTCGGAGATG
CCAAGAAGGCGAATACAGTATCCAGCACCTCCTTCGTTGTGTAAGCAGGGCTCTCGTTCGCTCCCTCGCACGGGCCTGCAGACAGACAAATGCAGCCGAA
TCCAGTCAGCTGAGCAGCGCTTGGGCTCTTCGGCGAGCGCGAGGACGGAGACGACGCAGTAGCAGAGAACGCGTCGTCGCTGCTGGTTGCCGTTCCAGTG
CCGCTGGGGCCACCACTCGCAGCGAAAGCCGTGGCATCCCGACTCAACTCGGTGTTCAGCGGGAAGTCGGACCGGGACCAGGAGATGCTGTGCTGCGAGA
AGAAGCGCTTGAAGCCCGAGTTCCAGGACGGGTCGATCTTGTGCGAGCTCTCGATGAAGGCCACGTTGCCCAGTCGGCTCTTGAGCTCGTACCGGTACTT
GGCGATCAGCTGCGTCACCAGCACACCGCCGTAGCCGTACGCGATGAAGTGCACCTTGTGCGCAGCCGAGGGGAAGATGTAGTTGCGCCACACGTGGTCG
CAGTGCTCATCGGCGTTACTGGATCCTCGGATCGGCATCTTCTCCACGGTCCCGTCCTGCGTAACCATAAGCTGCGTGTTCATGTTGGGGTTCATCACGA
GGATGCCGTAG