Description :
From Genome Similarity Track
Location :
Scaffold_463:10430- 11817
Sequence
1387 bases(100 bases per row)
CGTCCGCGCGAATTGTATGCAAGGAACAGGCCTTAAACTACCAACGTACTACCGCCTAGCGGTAGATAGGTTTCTGCTCTTTCGGGTGTAACCAGTTGTT
TTTCATTTTTAAACATTAATCTTAGTAGCAGCTATAGTTGCCGACAGTAAAATATAGGTTTAGTTGCCGACATCCTCTCGGTATGTGATCTCCATTAATC
CTACGTGAGCTCGTCATCGTGTCTTCAAAGTATTGTTGGCGTCTGTATCAATGCCGCGGGTCGCCGGGCGCTGCCCGCATTCGTTTCGAGGCCTTATTAA
GGTGTAGCGCACTTTTCGAGCTTGTTGAATCAACGAAACATCCGCCTGCTGACGCTGGTAGTACGTGTGGAGTCGCTACGGAGTCATTTTGATCAATCCA
GGGAAACCTGTGATCAGTATATGCACATAGCGTACGATGCCTCCACACAGCCTGGAAGTACAGTTTCAGCTGCTCTAGTGCAAGTAAATAACTAACCCAC
TCCTGAATCCCTGCATTCGCGTGAGATGGCTCCATTTTTGTTGAAGTGCAAGTCAATAACTAATCTATCCCTGATACTCCTGTGGTCGCGCTGAGATAGC
TCCATTTTGTATAGGAGCTTTTATGGGGGAACCCAAAAATAAGTGAAGCACCTAAAAAATAGTTGTTAAGGCTTCACACATGTGGGTGGCCTAGCAAAAT
ATAGTATACAGCTCCCGATTGTATTTTGCTTAATTACAATAGGATATGAGTAAACATATTATTTATAGGGACAAGCGGGATATGAAAATCTTGAAACCAA
AGCCGGGCAACCTAAAACAGTGCAATCGTGACAAGTAGCAGCACGCGACGCGTACATTTAAGTCAACCTATCCTTGTCAATTTTGTGCGTGCAATCAATA
AGAAGGATTACGCGGTGCCCGCTCCACCATCTCCACGTAAATTAAATCATTGTCTTAGGCTGGAAGAATATGTGCGTGGCACTGTTGTGCATGTCAGGTT
CAACGGTTATTATAACTGGTTTATGTTCGAGCACTTCCGTTCAGGGTTCCAATGCACTCAATCCATGCCGCTGTTTGAGCTTTTACTTGTAAGATGTGGT
ATTGCGTCCATCGTCCTAACCGGATAGTCTTTCCGAAGGGACGCTCGACCTTATAGTCCGAGTTGCACCGATATCGTGAAGTTGTGAGATGTGATCCACA
ACGACAACCGTTCTATGGACCCGTCGAGCGGAAGGCCAATTCGTTTTTGTGGCTGCGGCATGGTGGCTGTCGTGCAAATCGCAAACAGTATGCACGGTCT
GCTTTTCATTTCTTAAAGGAGGACGAGCACGCAAGGACAGCCCACCCTTTGTTGTCTTTCCTAAGAGGTGGTACCTTAGAAGACCGG