Description :
From Genome Similarity Track
Location :
Scaffold_37:104293- 111325
Transcript NameFunction/comments
Phyke_g2216hypothetical protein

Sequence
7032 bases(100 bases per row)
GAGGTGCTGAGCAAGCGTAACCACGCATCCAACAACTTCCAAGCGGTCTGGGCATCCTTTGAGGGATGTTGTGCTAACAATGTTGAACGTTCCACTGAGG
TGAGTGGCAGCCTAGTTTTTATATAGAAGTTTGtaaggcaacttcaacttacAGTGGCCAATCGGCCTTCGTGTCCCTTGGCTTTTAGTTAGCGACGCTT
CCCCCACCCGACAAGATCTCACATAAAGCGAGATCTTGTTAAAAAGCCGTGAACAGCCGCTTCGCTCTGACAAAAGGCATTTGTCTGGCATCCTCACACT
CTACCAGCCCGTGCAGCCTCGACGTCGTTCGATCAGGCTAGCAGTGTAGGAAGGAATCCAGGCGACGAGACTAAGAGAGAGTGAGAGGAAGAGACAAACT
GGAAAACAACCAAGTGAAAACGGGCCATGGGGCAACAGGTGTCACTTCCTGCGGCAGTGACGCAGCCGCAGGGTGGAAGCGAACGCGGCCAACTCCGACC
CCTCCATGCGCCTTATGTACCGCTCTGTGACGTATTGAAGGCTGGCGAGTCGGGCGTTGCAGTATCGTCGACTTCCGAAGACATGAAGGACGCACTGGAC
AAGATCTTGGAGTTTGGGGCGTCACTACGATACCTACCGAAAGGTAAAAGCGTAGGTTCTAAAGGTAATTGTTGAAGAGTTCTAAGTCATTTTTATCCTG
TACAGAGAGTGAAGTATCAGGGAGACTGCAAAACCGCAGTCCGGAACAACAGATGAAGGAACTCATGAGCTCTGTGGATTTAGTGGAGGAACTTTTCCAG
CACATTTCTCAACTGGCAGGACTTCCAGTTCAAGATGGCTACGATGGCACAAGACACGATGGAAAACGAGATGTTGGCGATGCCGTGACTGGCATCTTTG
ATGCTCGCGTGGCCAGCTACGTGAAGAACTTGCAAGCTTTGTACCAGATGACGAAAAAAGAAAAGAATTGGTACGAACAGAGATTACTGGCAGCACGTGC
ACATGCCATGTCGCTACGCCGAgtttcaccaccaccactaccgcTACCCACACAGAACTGCATGACCATGGGCTGGGATTTGGTGATCATGCTGCTGAAA
GCTACGAGGAAGGACAATCCCGAACAGTATGAGCATGCGCTACAAATGGTGAAGGACAACTTGAAGCAATTGAAGCCTACAGCATACTCAGACAGTGTTT
ATCTCGCACCGTCGGCGTCATCAGCATTCAATCTTCTGAGTGAATGTCTTGGCGACTTAGCACAGCCGCTGACCGATGTGGCGACTGAAATTGAAACACA
CATGGGAGCTCGCACAATTGAGACCTTGGTAGAGGTGGGGTTGGCTCGTGGATCGCTCGCTACGATACTGTTCGTGGTGCTTTGGCTGATGAAGCAACCG
CCCAAAAGTGCGGTGAACTTAGAGGTATCCATCAGCAAGCTTGCAACGCTAAAAGAACAGCCCATGTATGGAAAGTGTGAGGCCTCAGGCGAACTCTATA
GTTGCGGGCAGAATTCATACGGAGAATTAGGCACAGGAGACGACATTGAGCGTCATCAACTCACCAGCGTCTCACTTTGCGGATGGGACGATATCCGACA
GGTGGTTAGTGGTAATGAGACATTGGCGATCCTAACAAATGATGGCGTCGTGTTGACTTGCGGGCTAAACAAAAGTGGACAGTGTGGTCAGGGGCATTTT
GATGAGAGAGTGATGTTGCTCCGCCCTGTGCAAGCTCTGCGGTCTCAGCGGATAAAAATTATTGCGGCGAGCAACGGTTGCGAGCACATGATCGCGCTGA
CGGATACGGGATTGGCTTACTCTTGGGGTTACAACGACCGAGGCCAGTTAGGACACGAAAATTTGACAACGAAAATTCACGCCCCAAAGCTCATAGAGTC
TCTGAAGGACAAAAAGCTCGGATACGCTTCTGTGAGTTACCATCACAGTGCACTAATCACGGAATCCGGAGAGCTCTATACGTTCGGAATGAATGACTGC
GGGCAGCTTGGATTAGACCACACGCAACACCAGTCAACCCCTCAGCTCGTAAAAAGCCTCGAGGGTACTGAAGTATCCATGGTAGCTTGTGGGCTGTACC
ATACAATCATTTGCACTGCCTCCGGGGAGCTATATTCATGCGGAAAAAATGACTACGGACAGCTGGGGCTATCCCACAACCGCCAAGTCAAGATACCCAC
GCTTGTTGCACTGCCAAACGAGATGGTATGTTTTGTCGCATGCGGCTACTACCACTCGACCATCGTTACCACTGGCGGCCGAACCTTTTCATTCGGCCGA
AATGATTATGGACAGCTCGGAATTGGAAACAAGACCCACCAAAATGCACCGAATGTTGTTGCTCTGTCTGCCAACACGCGAATGGTGCGGGCAACGTGTG
GATGCTATCACACGGTGTTGCTCTCTGAACAGGGTCAAGTATATGTTTTCGGACGGAATAACAAAGGACAACTCGGGAACCGCGGTAGTGCAGACGCATT
GTTGCCTGTGCCATTGAAAGTTCGTCCGGAGAAGAACTCTCGCCGCTGCATTGACGTCGCCGCTGGTTTCTATACAACATCACTGATTGTGGAACGCAAG
CGTGAGAACGATGACGGGGACGGGGACTCGGTAATGCTGGATCAAAGCTGCGTCGTGCCTGTGTGTGGCCGCGTTGACATTGATCGCTCCGGGGAAATTG
AAGGATTGAGCAACTTCGGTTCGATATCTACAATTGGAGTATCGCTCTTCGGAGGCAAATGGTTTTACGAAGTAGAAGTGGTCACCAGTGGTTTGATTCA
AGTGGGGTGGATCGACGGCTACTTCCAAGGGAGCTCAGACCAAGGCGAGGGAGTTGGTGACCATGCTCACTCTTGGTCCTACGATGGCAACCGCCAGAGA
CGGTGGAACAGTGGGTCATCTTCATATGGAGAAAAATGGAAAGCAGGCGACATTATCGGTTGTATGCTGGACTTAAACGCACAGGAGATGACGTTCTTCC
GTAATGGAGTCAACCTAGGTGTTGCATATTCCGAGTTCAAGTGTTCTAAAGACGACAAAAGATCGGGAATGATGCCTGGCCTCAGTCTAGAACGTGGTGA
AATTATCCGCATTAACCTGGGACACCAACCCTTTGCGTACCCTCCGACGATTGCCCGTGATTTTGATAGCATTTCTCGTGCAGTGAGTACTCCCTCTTCC
AGTGCGTTGATTAAGGGCACTGTGGATGAACCCCCAGGAAACGTTTCCGCTATTGGTCCTCCTCCACTGGAAGGATCCGCTTCAGTTCTAGTCGGAAACA
AGCTGTTTGTGATAGGTGGAATGGCTGTGAGCGACTCCTCTGCTTCTCAACCTTCGGAGCCTACCAACCATGTGTGGGCATACGATATTGACACAAAAGA
ATGGGAGCGGTGGACCGATTTCCCCATTGGAATTCGCCATCATCAACTCGTTGTGATTGATGACAATCAAATTCTTGTGCTTGGCGGAGAGAACAATTGT
GCGGCATCGCGGCACATGGACCTGTACAAATGCTCCACCATAAAGAACGCTGATGATTCGCTCCCATCCTGGACGTTAGTCCAAGCTGCAATCGGAGCGG
CAACGTCAATGCCGCAAGCTCGCGCGTTTCACACGGCCTCAACAATTCGTGTTCGACTCGACACGATTATATTCATGTACGGCGGCAAATCCGTAGACAA
TGAAGCCCTGGGGGACGCATGGTATTTATCGCTCGATGACTACGCTTGGTCCCGATTACCAAGTTCGGTGTCGCTCGATCCTGGGCCACGAATAGGATGC
TCCTCTGCAGTTATTGGCGAATGCGTATACATTTTCGGCGGGCAGGACCGCGAGGACAAGTTCAGATCAGACCTGTGGCGGTATAATACGTTTGATCGTC
TCTGGCATTTGTGTCACGATGATAGTATGTCAACATTGAAAGATGTAAGTACAAACCCGGGTACTTTAACGGGTGGAAGTTCCCGAAGTGATTTGCTACC
AGTGGCTCGAGTAAATTATAGCATGTGCTCTGATCTAGGAAATATTTGGGTTTTTGGAGGTGCGGATCGAATAGGGACGCCCTTAAACGACTTGTGGTGC
TATTCTGTGACATCGCAGCTGTGGAATCACGTCGAAGTAAACACTGAAGGAGAACTTGATGGGTGTTCCTCAGCAGCACTCTTCACGCGGACGGGTGTCG
TAACAGCGTTATCAAGTATGACAAATTACGATATATCCGCTCCAAGGGGTGACGACTTTTTCATGTTCGGAGGCCGCATGAGTAGCAAAGGGAAATCATG
GAGCTGCAGTAAAATTCGAAGCATATGCTCTGGAGACCCGTCGGGGTCGTTTAACCTTGATGTGACAAAAAACATTTCGACAGCAGGAAAATCAGGACAT
GTACTCAGTGCTCTCCGAGCAAGGAATAGTAGCGCTGGTAGCCGACCAAGCCAGCATTGTTCCGCAGAAACGTTTGACTCAGCTATTTGTTTGCTGTCTC
ATCTGGATCGTTTGGTCGGAAACGACATTCCAGTAGAAGATGCCGACTCCGTTCAACTTTCGCGGTGTTTGTATCGATCTCTTTGTATTGATACAAAGGA
GACGACATTTTCAGCCTTATACTCTCTGTTGGAAAACATTACGTCGCGATTTTTCAGTATGGATGTATTAGATGACAACTCAAGCAATTTGCCGTTACTG
ACCCACGTGCTCTACCCACTTCTGGTGACGatcaagctgctcaagtttAATTTTTTTGAGGTATGTGTTTAGCCACTGTATTTGTTGAGATTATGCCGAT
GTTTCCCCCTAACTCGATTATCACTGTAAATGGAACAGTTTTCACGGAGTTGCTTAGACGGGTCAGAGATTGGATTGCCAACAACGGCTATTCAACCAGG
AGGAGTTCTCTATTTGATCCGGGAGCTACTTTTCTCAATCACGGATCACATGCCAAAGCTCTCAATATCTGGGGAGACGCTATGGTGTTATCATGCAGTG
AAGCAGGAAGCTGCATCGGCAATTTATTACGGGTTCCCAACTCTTTTTCCGTCTCTTTTGGATAGGTTGCAAGTGATGAACCGCTTGATGGCGAACAAGC
ATTCCACTGAAGCGAGATCAACCCCTACGCAAACACTGTTGATTCCGATGCTGGTACCACGTTTCACATCAGCAAAAATGCTATTTCAGCTGATGAGTGA
TCCCGATATGCTGCTAAAAACTGAAGGTTCATCGGAAGCTGTCGTAACCGGAACTGTCATTACGTTTATTGATACACTATTGGATGCGCTTTGGGACAAG
ACAAAAGAAGTGATGGGATTAGAGGATCCGTCCAATCTCGTGAGAAGTTTAGAGGCCCTTGAAGGTAATCACGAATTCAAGTGTTTGAATATCATGCTGC
GGGCAGCTACATTCTGGTGTTCGTGCTCCACCACCCATGGTTGGAGGATAATTGAATCTGTGTGCGCAAGGTTGGTGAATTTTGTATCTGAAAACCTGGA
TCAACTCAAGACCATGCGTGTGGAACAAAGCCAAACCCTGCCAATCCTAATCCAGCGTAGTTTTCCTGGCAAGCTGCTTCCGTTTATTTTACTGAGTGTC
TTCTCGCTGCCGTCAGTGCGAGATGGTCTGCCGGCTTTGCTTGATCCGTTCTGGCCGCAGTTGGAAGTTCTTTCAGTCAAGCTCCATGGTGCACTATCCG
TTTTAAAAGACCGAGGAATGCTGCAGCCAACCACTATAAACCACCCGATGCCTGAAGCTTCTGGCGCAAATTCGAGTGAAGCGGATTTCATTGACAGCGC
GTGCGTAACTGTTTCGAAGGAACTGGCAGGATacctcttccagcagagTAGTGGGTATTCTGCCACGTACGAACGCATTTTCAAGTGCTTGTGGGACAAG
ATTACCCAGTCGAAGGGGTACACATCATGGAAAGTAAAGGACTTGCCGCTGGATGCGGAGATCCGCCGATTGAATGTCCCTTCAGAACTTGCAAAGCTTT
TGGGGACTGAAACACTTCTTGTCAGAGTCCAAAAGAGTGGGGTAGAAGGTGGTGTCCAAGAATATGACTCGAAAAAAGTCACGTTTGTGCCAAGCCGTAC
GATTCTGTCACAACACATCTATCCCATAGGTGAGACCCACCTACCTGCTGCTACTAGAGCAGGAACTGTCGTGATGCCTCCTCCTGTGCCTCTTGAATCA
TTAAAGGTCAATTCTCCAGTGACACAATGCGCCGATAAAACGCTCGAGGAAAGTCATGAGTGGCTGAAGGATCTTCAGAAGGTGTTAGCCTGGATTGGAA
GCCATTATGCTGCAACGTTAGTTGTCGGTTGTGAAGTTGATACCGGTGTGACTGCCAGTGAGCGGTGGCTCAACTCGCCACTATTCCGTGGTGGATTAGA
AGAGACAAAGCCGTTTAATTCGGAAAGTAGCGAGGTAGATCGGAACGCAGCCCTTCTTCAGCAAGTGTTTGACAACGTCGGTAATGGCAAAAAACTTCTC
GACAAGGTTCGAAATGCTTTGGATCCCGGATCAGCACCTGGGGCGGGTGGTGCCAATCCACAGCTGCGAGTTGCAAGGCTGAAGAGACAAGATAGCGTGG
AGGCAACACTGGAAAAGAGTGGTGGAATTGAGGCTGTTGATCGTGCTGTTCGCGCCACCTTTGCAGCTCTCCTGAAGCACACTAATATTTCCTACACCAC
TGAACCTATTTCAAGTGATGGTGCACTGGCCGAGACGGTGATTGACGCGTGGAGGGCTGCTCTCCAGCTTCGTAGATGGTGCGTGATTTTGTGAGTTCAA
TATTTTTGTTTCGCATTTACTGATCTTTATTCGTTGTGTATATTTCCGAGTTTAGGATCGTGCGAGAACAGCAAAAACTAGCAGCAGCTGTCAGGTATAG
CTTTATTTCTTCGTAGAGGTTGTAATGTCTCGTTGTCCTGGTATTTAATTTTATTTTGCTTCGTTGCGCTCTGACATCCGGTAGTGAGACGGGAGCTCCA
AGCTCCTTTTCTCCTGATATGGACGTGAAAGA