Description :
From Genome Similarity Track
Location :
Scaffold_198:104290- 108134
Sequence
3844 bases(100 bases per row)
GTCGAATGCACGATCTTGAAGTTCATCGGCAATAGTGTGACAATGTTCATAACATCACGTAAGTGTGAAATTTTGGGTGAGCGTCTCCCGGTCAAGTGTT
GTATGATGAGTTGGCTACTGCCAACGACGTGACCATTGTATAAATGGTATGCGTAGTCCTACCAGTAGACCACTGTAGCCCGCGTGATTTTTCGTGTTTG
TCTTGGCTGCATATAGAGTGCCATTATAAGCAAAAGGGCAGCTTGATGCAATGCCCGTGATTGCGAATGGGCGTATTTCTGCTGATGGGTGATTTGGTGG
CTCCTTGGTGGAGTCTCAAGTGCAGCAATAGGGGGCACGTTATCTGTTATTATGCAAGTGAGGGGATTGGCACCTGCACCGTCGCCTCCGTATCGCTTGA
ATCGTCCGTAATATCCCAAGCCTCCAAAGTTATTGATACATCCGGTCAGTGATAACTCCCAGCGTTTGGGGGGCGAGTGTCCGTATTTTTTTATGATCGC
CCATACCCCTGGAGGTACCGAAGATAGTTTCATTCCCAGAAGGTGCGGTGCTATCGTACTCGAATCATCTCTACCTAACGTCTTCCACGGTCGGAGAAAG
GTATCCCATAGTGGTTGGGCTTCGTTGCAAGTCACGAATGAATGGAATATGCCTGAAGCGGGTATGGCATCCGGTCGATTAAGATACACGCATGAATAGC
CACGGCTTATACGAGCACTGTGTCTGATGTTGTTGTCTCCGAGCTCGAGCGATTGTCTCTTGGATCAGCCTTTTGGGCTCAGTAGCTGGATGCAGTTGTA
CTTGTACGAGCGAGCCGTCAGTATAGCTGTGTATCGTAGATGACTTGATCGAACCGTTATCCTACTCTGAGTGGAAAGAGTGCGGCCGTGCGACGTGCCT
TCGACATGCACATGATCATTAAATTCAATCATAGCAAGGTGCTCTGGACTGACCAGAAACATTTGGTCCGCACGTGTATTCACGGAGAAAGCAATAGAGT
CTCACAAGTGTCGAGGGTAAGTTTGAAAGCATGAAATATATCGATAGCTTCCTCAGGTCAGCTTCCCACCAGACGTCCAGGTAAATAGCGACAGACCGTT
GAACCATTAGTCAGCTTACCACGGTACTGTTCAGCGCACTCGTGAACACTCCCGCTATCAAGGCTACCACTAATTGACTCTACACCAACTCATCGCCCAG
AATATGCGCTCACATTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCCCAGAATATGCGCTGACAT
TAGCTATATAATGTACGACCAACGTAACGCGTTTCTTCGGGTTCGCTAGCACTGACGACTTGATTGCGTTGAAGCTCTGGCACTATACCTGCTTTTAAAT
GGGACAGAACTGGCTTTTTGCTTTGGGATCCCAAGATACACTCACATCTGTGCATCACAGGGTCGGGCATATTGACATGAATGAAGGCAATAGCTACTGT
CAATATGCAGACTGCAAAAAAGGATACGTTCATTGTGGACGCCGGCTGTGTTTCTACAGCACAGAAACGTCAAAGACGAACTCTGACACCGGCCGAGCGG
AGCACACGAATGATGTCTTAAGAAATCGCCGTGCGTAGAGCTTCTACGAACGTTGTCACTCGAAGCGGTCAGCTTCGTTTCTTCGTCGAGCTAAAGAGGA
TGTTCGCGGTACACGTGCTCAGTAAGATGCCGCTCGTTTTTGTAAGACATCGTAGGTGTGACTCTATATCCGATCGATGCAGCATTAACACAGGGATACC
ATGTTGGTCCTGTTTGTCCCGCGACAAGCACATCATCGCGAAAACATTGTGTCGACACTATTTCGGTGGGAGAATACAGCACCGATATGCACGTACTTTC
AAGGCTAACTTAAACTCCCATCTGTGTCTCTTGGTCTGACCTTACGATGAAGATGAGCTTGATACGACATGCAATGTATTCCAAACGCACAAGGTATTCT
TACGCGAGTAGCTGCTAGCTCTGTCGACATGCGGCACGGATGACACCGGTTGTAAAGTAAGGGCAGCAAGATGACAGCGTCTTCTACATGAAGTAGATTG
GATGCAGACTGGGCGGTTCTTCGTCTTTATGATCGTATCCTCCAACGGACTCAGGTAAAGAGTCGAGAGTACAGGAGGAACCTTCTTTGCGTCCGAGTTG
TCTTTACTGAATCGAATGTAAACTGGATGTCTTCCGGCTTAATGAACACGAAAGGTAGACCAGAGGAGGTCGTAAACATCTCAAATCTCGGTGAGGAAGG
CCACCTGCAGAAAAAGTCACGACGTGTAATCAACGGATGAGTCTATCAGCCAGAACCTCAACTGGAATCTTTCGTTTCGCGTTCCCCGCAGCTAAATGTA
GTTTCTTTGCCTAGCCCAGAGGAACGCTATCGAATTCTCTGGCT