Description :
From Genome Similarity Track
Location :
contig_2:1042740- 1046231
Transcript NameFunction/comments
g743.t1hypothetical protein
g744.t1ETI49621.1 arginine-tRNA ligase [Phytophthora parasitica P1569
g745.t1hypothetical protein

Sequence
3491 bases(100 bases per row)
AAGCTGCCCGCCGACTCGGCAGCTGCGAAGCCGTCGTGAAGCGCGTGTGTCGCCGGAAGCAGATCCAGCGGTGGCCCTACCGCCAGGTGTCGTCCAAGCT
CATCAAGATCCAGCACCTGTGCAAGTACATGGCGCACGTCTCGGATGCCGAGCAGAAGGCCCGCATCCAGCAGAAGATCAAGCAGCTCACGCAGGAGTAT
CTGGAGCTCGTCGGCGGACAGGTGCCGTCCGAGCTGCAGCTCACGCCCGCCGACGTGCCGACGCTGCCGCCGCCGAGTTACAAGGGCGACCACCCAATGG
AACCGGCCGTGCTGGCCGCGGCATCCGACGACGAAGCCACGCACGAGGACGAGGAAGAAGACGTGGAGTCTGCCAGCGAGCAGCGATTGTCTGCGTACTC
GCTGCGCTTCATCCTGTCCGACTGCACAGTGCTCGAGACCGAAACAGGCACGCACTACACCACCGCATAGAGCTGCGATGTACTTTTGTCTACATGTCCA
ACTACCTGCATACAGTACTAGATAGAGCCTTCACGTGAGCAAGTTTGCAAAATGCCTGCAAGTTAGAACTTTTCCTAATCAAATATTGAGCTTCATTCAT
TCCCTGAAAGCCCAACCAACACTTTCTCGCCTGGTCGACTGATAGTAAGCGCCGCCACCGATGACTTAGATCTGGTCCAGCGGGTCAATGCCCAGCAGCG
AGAAGCACGCCTTCATGACCTTGAGCGTGGCGTCGCACAGCAGCAGACGGCTGCTCTGCTCCTCGCTGCCCAGCACGCGGCAGGCCGTCGCGAACGTCTG
CACCTTCTCCGAGATCGTGTACAGGTAGCTGCACAGCCGGTTGGAGTTCAGGTCCTTGTTGATGAACACGATCACGTCTTGCAGCTGCAGCAGCTCAATG
ACCAGGGCCAGCTCCGTCGGGTGCTCCGGCTTGAGCACGTCGCCCTGCTTCTGCTGCTGCTCCACGAGCGCAGCCATGTCGACGCCTGACTTGCGGATAA
TCGAGGACAGCCGCGCGTACGCAAACGTGAGGTACACAGCCGTGTCTCCGTTCGTGGACAGCATGCGGTCGAAGCTGAAGATGTAGTTGGACGTGGGGCT
CTGACGCAGGTCGAAGTACTTGACGGCGCCGTAGCCAAGCTTCTCAGCGGCAGCGTCCACCTCCTCAATGGGCAACGACGTCTGTCCCGCCTCGATACGC
TCCAGCAGCTGCGCCTTCATGCGCACCTTGGCCTCGTCTAGCAGCTCCACCAGACGCACGACCTCACCGGAACGCGTCTTGAAGCGCTTGCCCGACTCGT
CGTTCACCGTTCCGAAGCCCACGTGGTCCGCGCGCTGCTTGGTCGGGTCGTAGATGCCCGACATCCGACCAACCTCGAACAGCAGGTTGAAGTGGTCCTT
CTGCGTGTAGTCCGTGTAGTAAATGATACGGTCCGCCTTCATCTCGTGCAGGCGGTACCACAGAGCAGCGATATCCGTCGTGTCGTACAAGTACGAGCCG
TCGCTCTTCACGAGCATGAACGGCTGCTTGAATGCCTTCGTGAACACCACCTCAGCGCCGTTGCTCTTCTCCACAAGGCCCTTGGCACGCAGCTGGTCCA
ACACGCTCGGGATGATCGGGTTGTAGAACGACTCGCCCATTTCATTGAGTGACACACCGAGGCGGTCGTACACCTTCTGGAACTCGCGGCGACTGATGTC
GCACAGCGTCATCCAGACCTTGCGGGACTTCTCGTCACCAGACTGGAGCAGCACCACCTGCGCCTTGGAGCGCTCGTGGAACTCCTCGTCCACGTCGAAA
CGCTCCTTAGCGGCCTTGTACAGCAGCGTCAGGTCTGTCACGTTGGGCATCTCCGTCTCCCAGGTCGGATACGTCTCCGTGAGGTGGCAAATGAGCATGC
CGAACTGGGTGCCCCAGTCTCCAACGTGGTTGATGCGCTTGACGTCGAAGTTCTGGAACTCCAGGATGCGGCTCATCGTGTCGCCAATGATCGTGGAGCG
TAGGTGGCCCACGTGCATGTCCTTGGCGATGTTGGGCGAAGAGAAGTCGACGACAACCGTCTGCTTCTTCTGGGGAGCCGGCTGCACGCCGTTCACCAGC
ACGTTCTGCAGGCGCTTGGCCACGAACGCCTTAGTTAGGAAGGCGTTAATGAACCCCGCGCCCGCCACGCTCAGACGGTCCAGCACGGGCGTCTCGGGCA
TGGCCGCAATGATCGTGTTGGCCACGTCCCGCGGCGAGCGGGCGGCGTTAGGCGAGCCCTTGAGCGCCGTGAAGATGGCCATGGCCGAGTTGCACTGGTA
ATCGCCGAACTTGGCGTTCTTGACGTTGGTTCGCGTGACCTCGACCGGCGGGACGTCCAGACCCGGGTACGCAGCCTTAATGGCAGCGTCGAAGATGGAC
TCGACCACCTCCAAAATGTTGTGGTACGTCAGGCCCTGCGCGAGCTTCTCGTCCAGCTTGAACGTAGAGCGCACAACATCTTTGGCCGCCGTTGCAGCCG
CCGCGGCGGGGGCGCCGCCCTTCTTAGCAGCTTTACCGGCGTTCTTCATGCTGGCCACGCCCTGGACCACGTCCGCGCGCGCGAAGAGCTGCGTCACGTA
CTTGCGGAACGTCTGAAGCACCTGAGACTCGTCCTGCTGCTCCTTGACAAGCTTTAGAGCCGCGCGCAGCGTGACGCCAGCCACGACGTCGGCCAGCGAC
AGATCCGAGCCGAAGAGAAACAACAGGTCGCCGCTGTTCTTGGCGCGCGCCTCTTCCTTGGCCTCCAGCAGCGCAGTCAGCTGATCGGCCAGCTCGCCGC
TCTTGTTGCTGCTCGCCGCCTTGGCCACGCGCAGCCACGGGGCCAGCACATTGGCCTCCCACTCGAGCCACTCATCCACAGCCAAGTCCTCGCTCTGCAG
CTGACCGGCAGCCGAGGCCACGTAGCGGCACACGGCGTTGGCCGAGAAGAGCAGATCAGACTCGGACTCGACAGCCAATTGCGGGCCGCAACTCGCGTAC
TTTTTGTCGGCGGCACCCACGGAAAAGGTGGTGCCAGTGATCGACAGCGCCAAGAAACACTTGAGCTCCTCGTCGCCCGGCTTCTTGCCGATCAGGAGCT
GCATCGTGGTAAGAGAGGGAAGGTCGAGTCGCGGTCGGGTCTCAATTGGCCTAATGATGGATGGCCATTAGAAATGAGACCGTACCTTAGTGAACGTATA
CAGTGGTATGTCCCCTTTACTACAACTAAGTGAGTTGTATTCAAATGATTGATCCTCATTGTCCCCTCTTGCCTCGACCAAGCCACTCGATAAATCTGAT
GGCGGGACGTTCGTCTTCCGGCGGCGATAGCGCGCGGCGCAGCGCGGCTGTGCAGCGTCTGATGGACAGCGCAGACCAGTCGCTGAGTCTTCTAGCGTCT
CTGGGCGACGCGCCCCTGCTCGCGCCCGATTCGGGACGTTCCAGTCCCTCGGTAAGGGCCACCGCAAACGGGATGAGGGACGACGAAGACA