Description :
From Genome Similarity Track
Location :
Scaffold_934:10426- 11784
Sequence
1358 bases(100 bases per row)
CACTGCAGTGCTAATAGTACAGTATCCCCTTTTCACTAGACGGATTCAAGCCTTCCCTGGTGCCAACCGCAGCACAGGCCACCTGGAGCCCGTCAAGAAG
TTGCTCATAGTCGACATGGTCGGCAGTCGAACAGCTTCAACTCCTTCAGTGTCGGGACAACTCGACGCTCGTGTGGTACTGGCATAACTCTTCGATATCC
CGTAGCGTCGGAATGCCCGTCGACCAAAGCTACGACAAGCGCACTACTTTTCGCACCAGCCAACCACCAGGTGGAAGAGTGCTGAGGCGAGTGAGAGATA
GAACTTGCTGACGCCGTGCAGGTCCGGAATCGACTGGGGGTGTGTCAAAAATATTTAAAGGCGCTAACGGATTTTATTGGGTCTCAAGAAGTTATAAAAA
CCTAGCCTCGATGATTTACTTTAGTCAATAAACACTTTTACATACTTTATCTAAGTATTTTGAAAACCCTATCCCGCGAAATCTTTTATCCTATCCAAAC
CGTTTCTTTGTCTGATTCCGCAAATTTCTATTCGCCAATTAGATCTGAGGGCGCTTCCGTTAAAAGTCTGGCCACCCCCAGTCGATTCCGGAAGGGGGTC
ACTGGGTTAGCCGCTTGTGCATTCAATCAGAGAGAGAGAGAGAACATTCAAAGCAGAGTATATTGACCGTTGTTGGCCCAATGGGCAATGCAGAACGCCG
TCATGCACTGACCGATATGCGACACAATCGGCAATAGAGACCACCGCTACCAGTAAAAAAANNNNNNNNNNGAATATCGTGAACTCCATTCTCCCAGTTC
CCCTCTTCTTGTGATACTATCCCCTGCTGTAGTGTTGTTCGCTTGGTACAGTACTATCCCTTCTAATTTTGTTTTATCGACTAAAACTATCAATCGACTT
TCGGTTCTAATCTGTTTTATAGACTAAAATGCTCTAAATTGTAAAAAAACAATTTCGTCCATAAAACAGATTAGTACGGAAAGTCGTTTGGTACTTTTTA
GTCTAACGTTATTTATCAGAATGCTTCTATAAACTCTATTTTAGTTTTCAGAACTTCAAATTTCAGTCTCAGAGATGGGATATCTGAAATCCATTCTGGC
GGTCAACTCAAACATGGAGAGTTGGCCCAGGCGCGGGCTAAAGCCGTATTCAGAGGCCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCCG
AAATCGATTGCTGACTGACTGTTACGCTTCATGCAAGTACGCCGAAAACACCACCGCGATAAGCTCCCTAATGAACGTCTCAATGATGTTTCACATTCCG
GGTTGGTGTGAAACTAACGAGATCCGCGACGGATGTAGAACTCTGTAAAGAGTTATTG