Description :
From Genome Similarity Track
Location :
Scaffold_34:104254- 116456
Transcript NameFunction/comments
Phyta_totarag1712hypothetical protein
Phyta_totarag1713phospholipid-transporting ATPase, putative
Phyta_totarag1714hypothetical protein
Phyta_totarag1715hypothetical protein PHYSODRAFT_353483

Sequence
12202 bases(100 bases per row)
CGTTTGatcagcagaagaagtttgCGGTGTTACCAGATACGCCGTCGACCAGTAGTACTTCATGGCACGCGAGGTCCGCTGATTTCACCTCCACTCTGTC
AACTTCAAAGTGGTGAGGCAGCACTTGGACGGGTGCGTAAGATGTGGTTGCATCTACATCGTGAGAACCCCAGATTTCACGATAGCAATCCTTGAACGGC
TTGCTCAGATTCCAGTCGATATTGTCTTCTCTAGGAAGAGCAGTGTAAAAACCAAGCTGATTCAGCGACTCGTCATACCACTCGTTCCTCTCTGTCGGCT
CCCTACCGAGTGGGGAGAACAAATCTTGGACGCGGGCTGCTGGTTGTCCTTCCGGTCGGCACCTTACAAAGGTTCCCGACTGTACATATGAGCTTGCACC
GCTTCGTAAAACCATTTTCTTACTTCCATCATAGGGAAGTGGCTCCCAGTTTGTCTTCTCACAGTTGCTAGCATCAGACATTCGAACAGGTCCCAGTGAA
AAAATGGGTGAGACGGCCAACATCGTCCCAGTGTGCAGACTTTGCCAGTACGCCAACGGTGGAGAAATCAAATGGTCTTCCAAGGCTTTCGATGTTGGGC
TTTTAAAACCACACAAGCTGGACCCCGTAGCGCCAAACATCGATTCACAACTCGGGTAGTCATTCCACCTCGCCCCACAGTCTTGGACTGCAAACAGCAC
CCTTGGATCCGTAAAAATATCGTAATTAAATCGGACGTGCTTTCGAGGATACGATTTGTCGCTTGGCTCGGAAGATGGTTCAAGTGACGTATCTATCATG
TTACAGCTTACCAAAACGGACATCACATCGTATACACGGCGGTGCACGTCACTATATGGCGTCTCGATATACGGCGAACTCGGCTCCAACGCGCCAATAA
ACTTCTTAGCTTCGATGAGACGGCCGCTAACAGCAGGCAACGTCACTCCAACCTGATAATCTTGTTGGAACAGCAAGCCCAGGAAGGAGACTGTCGTGGT
TACTAAGCACGGCCATTTTTCAACTGCTGCCTGCGCCTCAAAAACTTTCACGAGGGCGCTGTCTTCTTCCACGATGCTGGTCACCTTGGAACGGCGAGAC
TGCCGAAACTCCACCATCACATGAGCTGAATTGCTCTTCATGTCCGCCAGACGCTGCACCACCGCAGCCTTCCCGAAGTACAGGAAGTAGCCTCCCTTGG
TCCGTCGCATTTCGTCACAGCGAACCCGCTTGATCACTCCAATCCCTGCAGACGTAAACGTTTTCATATCTACTCTCTTTTATCAAAAACAATTAGTAAA
CTACAGACGCCATATCCTACCTTCCagtacgtgcagcacgtcgtaGATCCGTCTCTTCCTGGGCACTACGCAGCGATCGATAAGCAAGACCACGAAGCGA
GAAGGACGAAATGTATCCTACACGTCGTACCCTTCATCTTGTAGATTTCACTGGACGGGACGAAGATCGGGAACACGGGGCCAGACGCAGAGCCCTGCAG
GTTCTCGTGCTCCTTGAAGAACTGCAACATGATGCGCGTTCTAACCACGCCAGCCACACAGCTCTACGTTGGCACACAACGGTCATCTTTCCTTGGTCTT
GACGACGTACATTTCCCCCAGACTCTTCACTGCGGCGAATCGCTCTTGGATGTCGCTCCACGTCGCTTCTGCGAGGCCGTTCGTGCCTCGAGTGGAGCTC
CCGAGACGTGCTGGCACTGGACTAACGCGACGcgagcgctgctgtcgttttCGCCGCTTTATTGGGCGCTTCAAGGCGCTCTCCACCTTGACAGTCACCA
CTGGGGCGACGTCTTTTGTGGAGTTGAAGCGCAGTTTCCGTCGGTGTGCGCGTTGGGTCTTCATCGATTTGTgtctgaagcagcaaatCCGAAAGTGAGG
AGAATGCCAGTGTCCACAGTTGAAGTGACATTCATTCTAAAGCGAAGCGATCTTTTACTATTCAACCAGCACGAATGCTTCATTATTTCACCTTAACTAG
TTATAATGATACTGTAGGAAGAAGATAATGATTTTGGTAGTGGTCGGATAGTCGCTGCGttggacaagttgaagtgatgcAGTCTCAACAAAGGAAACAA
TGCAAGTTTTGCCAAACCAGACGCGTATCATTTTCTGCGACCCCTGTCGCTTTAGGTAAGTTGCAACCACGAGTCCATTCTTCTTGATACTTGGTAGCGT
TAACTATTATTTTGAGGCCGTCAATGATGCGCTCACTTTTAGCTTGACACTTGATCGCAAAAATAGTTGGCTCGCCCAGttgtgctgctcagcagtcGAG
GCAAAGCGAAACTCCTTCCTATGGCCACCCTGCTCTATTCAAAGCCATGGACCGTTAGTTTGCATCGTGCCAGCATCTTCGCCTCTCCTGCACTCGGCAC
TCGCTTTCACCTTCCTCTTTTTCTCTGGCAGTGGCTGTGCGTGACGGAGTGACTCATGGGTGAAGGAACGGCGGGACACGCGGGAGACTTCCGTGTGGTT
CATCTAAATGATGCACACCGCAACACTGAAGCTGGCTACTGCAACAATTTCATTGTCACGTCTAAGTATACGGTGGCGAGTTTCCTGCCCAAATTCCTCT
TTGAGAGCTTCCGCAAACTCTCCAACCTCTACTTCCTCCTCATCTGCATCTTGCAGTGCATCCCGCAGATCAGCAACACGGGTGGGCAACCGTCGACTTT
ACCACCGCTTCTTTTCATTATCACGGTTGATGGTGTTTTCGCCATCCTCGAAGACCACAAGCGCCACCAAGCCGACAATATTGCCAATGCCAGTCCAGCA
CTTGTGCTCAACCGCGAGACGAAATCATTTAAGTCAGTCACGTGGGCTGATGTCGTGGTAGGCGACATTGTCAAGGTTGGAAATCGCAGACTCGTACCGG
CCGACATGCTTGTGTTAACAGTAAGTGAAGTCCCGAACCAGCCCCCGTGTGGTATTTGCTACGTCGAGACCAAGTCTTTGGATGGAGAAACCAATATGAA
AGTCCGTTCAGCGATGGAGTGCACACTTGCAGACATGGGCTCAAGCGAAAATTTGGTCAATATGAAAGGTGTCATTCGCTGTGAACACCCGAACAATGCG
ATCAACAGTTTTCAAGGTgtactggagctggagggcAAAGATAAGGCTTCCATTCCGTACGAGAGTATTATTCTTCGAGGATGCATCATTCGGAACACAG
AATGGGTGCACGGTGTGGTTTTCAACACTGGCAAGGACACGAAGATTATGATGAGTAACTCGGCGCCTCCATCTAAAATGAGCTCAATGGACCGGTCGAT
CAATCAGTACACAgtcgtgctgctgacaaTCTTGGTCATCTTcagtgctgttggtgcaACGGGGGCAGTGGGCTGGAAGACGAACCATGACGCCGTGTGG
TACCTCAAAATGGACGTGTCCGACAACAGCATCGTTGTGGATTGGCTCATCATGTTGTTTTACTATCTTCTACTCATGTATCAGTTCGTTCCCATTTCTC
TAGCCGTCTCCATGAGCATGGTTAAGTATCTTCAAGCGCAGTTCATCCAATGGGACAGCAATATTTACCACCCCGACACGGACACGCAGACGCTAGTGCG
TTCCATGTCACTTAACGAGGAGCTCGGACAGATTTCGTACATCTTCTCGGACAAAACTGGCACACTCACGTGCAATGTTATGGAATTTCGGAAGTGCTCC
ATTGGTGGAGTTTCGTACGGCAACGGGACCACAGAAATCGGATTGGCAGCTCTAAGGCGTGCGGGTAAGCCTCTTCCAGATATGACTTCGCAGTCTAAGG
GGCCTAAAGTTCCTTACGTGAACTTCGACGGTCCGGAGTTGTTCAACGACATGAAAGGGGACTCAGGTTCCGTTCAACAGGGACGCATCGATGCCTTCTT
CACACACCTCGCGGTGTGCCATACCGTCATCCCGGAACGTCACGAGAATTCAACAGAAGTCACACTttcagcttcgtcgccgGATGAGCAGGCACTAGTT
GCCGGTGCTGGGTACTTTGGATACGAATTCGTGAATCGATCTCCCGGTGTCGCGCACGTCAAAGTTCGTGGTATCGTTCAAAAGTATGAAATGCTGGATG
TGCTAGAATTCAATAGTACACGGAAGCGCATGAGCACGATTATTCGTCACCCTAATGGCCGGATCTTCTTGTACTCGAAAGGCGCTGATGTGATCATCTA
TGGACTGTTGGTGAAGGGCAGAGGAGATGATTCGACCTCATCTCAACTACAGGAGATTACCCGGTGTCACATTGACCAATACGCTGAAGATGGACTTCGC
ACGCTCACAATTGCGGTTCGTGAGATCGAACCAGCGTACTACGCTGAATGGGCAACACGCTTACATGATGCGCAGAACAACCTGAATGAAATTGACAAGC
GTAAAAAAGACCTCCCGAACGCAATTGACCAATGCATGAATGAAATCGAGTGTGAtttggagctgcttggagcCACTGCAATTGAAGACAAACTGCAATC
TGGCGTCCCGGACACGATTGCCAATTTGGCATGCGCAGGCATCAAGATATGGGTGCTTACGGGTGACAAGGAAGAAACTGCTATTAACATTGGGTTTGCT
TGCCAGCTCATTACGAACGACATGAAGCTTTTTGTCATCAACGCGAAGAACGCCCTGACCCCAGAAGTGATTGAAAGCACTTTCCGAGATGAGATTGGAG
CCCGTAGCGCAGATGTCACCAGGTATATGGCGTCACCCCCGAGCACCAGAGGGGAGCTGCGTGCGCTGGCTCTTGTTGTTGACGGTGAGACGCTCATGTA
CGCTCTCCGCGGATCGTGCCGTCCGCTACTTGCCGAATTCTCTCAGTACTGCAAAGCCGTTATCGCATGTCGAGTGTCTCCCGCCCAAAAAGCCGAGATG
GTTGCTCTGATCAAGGAGTACGTACCTGGTGTTCGAACCCTTGCTATCGGAGACGGAGCAAACGACGTATCCATGATCCAAGAAGCCCACGTTGGCGTCG
GCATTTCAGGCCAAGAGGGTATGCAAGCGGTAAACTCGAGCGACTACGCCATCGCGCAATTCcgcttcttgcagcgttTATTGCTTGTACACGGCCGCTG
GAACTACCGACGCATGGCGCAGCTGGTGTTGTATATTTTCTACAAGAACATACTCTTCACCGCTGCTCAGTACTGGTACACACTGCTGTGTGGATTCTCC
GGACAAAAGTTTTTCCTCGAAAGCGGTACGCAGCTATACAATATCGCTCTTACGGCGATTCCCATTGTTGCAGCCTCGATCTTGGATCAAGATGTCAATG
ACGAAGTAGCCATGACATTCCCCAAGCTTTACTTCACGGGACCTCGTGATGAGGACATCAACACCCGTATCTTCTCGCTGTGGGTTGTGGGCGCAATCGT
GGAGAGTGTCATTATCACGTTCATAACTCTTCACGGCCTGCAACAGGCGGGTTTCGGTGGCGCTAGTCCGACGATGTGGCTGGAGGGCTTCATTGTCTTC
ACCCTTGTCGTGTCCGTCGCTAACTCCAAGTTGTTCATGTTCCAGAACAGTTTCTACTTCTTCAACTACTTCCTCTATCTCGGATCGGTCTTGATGTGGC
TCGTAGTTGCACTGGTATGCAGTCACGTCACGTTCCTCTCTGATCTCACATGGGAGCTCATGCTGGAGCAGGCATTTGGACTTTCGTCCTTCTGGCTTGT
CTATTTGTTCGTCCCAGTGGCTGCACTCTCGTACGCACATCTACTCAACGGTATCAGATCCACGTTCTTCCCGGAGTATTGGCACCTCGCTAAGGAGGTC
ATCAAGTTTAACCTTGACCGCAAACTTCTGCAGTGGAATGACAACAGCAATGCATCGGTGGCAGTACCAGCTCAGCTTCCGCATGGTAAAAGAtccgcca
agaagcacgGCTCAGTCATTCCTACTAATGGCCGACCCCTACAGCACAGAACAACGCTACAGAAGACATATCACGGGTTCGCTTTCTCCAAAGATGGTTA
TGCCGGGGCCACAGAGACTCGGTTACTCATGAGTCGTAGCTCTATCACAAGTGGAGCAGGAGCACAAGGTTAGACCATAGTTATGTTTTCACAATGCATG
AAATTATTCATCTTGCGTCGGGGGTTCCATCCAGCAgtcagcaagcagcaccgcaaACTAAATTAACGTACGTGTTCCCTTGTATGCGAGTCTTAGTGGT
GGAGCAGGCACCACATTGCCACTCTCCGCGTACCCGATTTGAGATATAAATTTTGCGTTTGGTGGcgagaagaacagcagctcgtcgatcaCACGATGCC
TTCCCTCCAGCGTCGTAGCTGCGTCAGGCCCAAAGTCACCAGCTCGACTAAGATACAATCTACACCCGTAGTGGCCATCATACATACACATCAGATATGT
ATCCATCCACGTGAGCAGCATGCACCTGCAGTACTTTGTACCTGGCAGCAATTCCTTCCAGCCTCATGCTCCTCTCCATTTCAGGAGTGCCATCCTCTTG
CCTTCGTACCAACGCAGAGCGCTGTCGTTTAACCCTATTGTATTTCTCAAGGAAGCGGAATTCGTCCTGGTCGATAGAAGCAACGAGGTGAAATGTGAGG
CGATGGGCACTGCAGCGACTCAACCGCGCGAAGCCGCGCAGGTTCCTGGCAAGACGCAGTCGCTTCACTGTCCTGGACACTCGCGCGTCGTGCTCCTGTT
GCTCTTTTCTTCTGCTTTCTTCGAGTCTCTCAGCTTCTGAGATCTCCTTTAATGCTTCAGCATTTTTCTCGTTAGCTGTTGATACAGTTGCTactcgctt
cttcttgttcgtgCTACGCCCCACCAATCGCTCGTATCTGGTTCGTCACATTCACGTTAGCGTTCTGTATCAACACCATAGTACAAGTGCTCCACAGTCT
AAGAACGCGCCTAATGGTTCATACAGGCGGTTGAAGTCGTCACCATTGCCCCCCGCCATTCGGTACAGTAAGCTTAGTGATAGATTTTTCAAATGTCCCG
AATTTATTTCCTGGTTTATTTTATGAAGGTGGTGAAAAACCTATTCTAAACCGCAATGGGTGAACCACCCACCCACTCAAATTTCAAAACGTGGTTTTTT
GTGAAAGAGCCCAGCCACAGAGTAAATAGCTACTgccaaggacggcaaggATGCTGCGCGTCTCCAACCTACTTCGAGGCTTAACAGCGGCGCCACTGAG
TCGTCGCACCATCCTCAGTCGCTCCTCTGTCCGTGCTTTCGGTGTGCAAAGCGgtggcgacgaagacgacgacgacgaggaggaggacatggAGCTTGAG
GACTTGGGGCTGGACTGggacgacatcgacgacgacgacgacaacgaaaACTggacgctggacgacgaaggcgacatggCCTCCACCGGTCGCcgcaaga
tcgaggagcACGTCAAGCAGAAGGTGCGAGTGCGCCGCGCGCAGCACTCGAAGCGCCGCTTCGTGGACCGCATCCGCGTCAAAGCGACTGGCGGCCACGG
AGGCAACGGCTGCGCCAGTTTTTTCTCCGAGTCGGCGATGCGCAAACGCCCCAATGGTGGGcacggcggcgctggaggtgACGTCGTGATTGAAGCCAAT
GACAAGATGCAGAACTTGGCAAATGCCACGCACCACTTCAAGGGAGGATCAGGAACCAACGGCATGCGTACGTGAACGGGAGACGATCGGGAGTTCCAGT
GGTTGGAGGACATTCCAGTGATGCTGACTGTGTTTGCATGTTTATTGTGTTTGTGGGTTACAGCAAATGATTCTGCTGGTAGGAGAGGCAAGCATTGCCA
TGTGAAGGTGCCGTGCGGCACGCTCATCAAGCGTGTGGAGCGcttcgagcgcgagctggagaacggCGAGTATGAGATTGTGGACCGGATGGAAGTCGTA
GCTGATCTGGACAAACCTGGCACTACGTTCCTGGCTGCCAAGGGTGGCAAGCCAGGCCTAGGCAATCGTATCCTAGCAGGCAAGACGACGAATTTTGGTC
GACTGCGCAAGCACATGCCGGAGAACAAAACCACGGGCCAGCCAGGCACCTCCCAATactacgagctggagctcaagactATCGCTGACGTGGGTCTTGT
GGGCTACCCGAACGCTGGCAAATCTACCTTGCTGAGTGTGTTGAGCCGCGCCACACCTGAGATCGCCCCTTACCCGTTTACGACGCTCCACCCGTACGTT
GGAATTGTGGAGTTCCCAGACACGTTCCGGTTGAGTGTGGCTGACATTCCCGGGCTTATCGACGGCGCGCACCGCAATGTTGGTCTCGGTCACGACTTCT
TGCGCCACATCGAGCGCACTAAGGTTGTACAAGATATGCTGCATTCTACTGTTGAAAATCTCGCTAACTTCAGTGCGTGGTGACTGTTAATGAGTAGATT
TTGATGTATGTGCTCGATACGGCGGGCTCTGAGGGGCGTGATCCCCTGGAGGACTTTACTCACCTTCAAAGAgagctggagctgtacgCCCCGGGTATCT
CGTTGCGCCCTTCCCTCATCATTGCTAACAAGATGGATGAGCAAGGTAAGAAAATGACTGTTCATCTATCCTATGCAATCACCCTTCGGTTCTGAATGAG
TATCCTAACACTGGGCGTGCTGTAACACAGGCGCTGAAGACAACTTTCACAAGTTGCGCCAGTCCACCGATCTTGCTGTGCTCCCAGTCAGGTAaagcta
catgtaatgaTCCGCCGTCCAGCAAAACCCGCAACTAATTACGTTTCTTGGTCGAACAGTGCACTCCACAAGGTCGACATTGATACGATAGCCCGCACAC
TCCGCTGGATGATCGAGAGCTACAGCAAGTTGACCAAGTCATCATAGAACGAGTACTAGTCGCATTGGCCGTATGCTCAGGAACACGGAAGGATTCTTCC
CCTTTCTACCATTTGTTCCTGTATTTTTTCCGCTGTTATGGTTATTAATAAGGTGCGGGCGTGTTTTcaggccaagcagcaaacgtCTTACCACTACGGC
CCAGGGCTTCGcgcggacgtggtggtggacttACAAGATGAATCGCTATGAGATGCTGGACCGAATCGGTGATGGTGCTTTCGGCGAGGTTTCTCGTGCT
CGCAGTCTTAAGACTCACGAGATCGTGGCCGTGAAAAAGATCAAGGCACTGTTTCCCACATGGGAGGAATGTCTTCAGTTGCGCGAGCTGAAGTCGTTGC
GGGTGCTACGCCATGAGAATATAGTGCTGTTGAAAGAGGTCATCCGAGACAAAGAGGAGCTCTACTTCGTGTTCGAGTACATGCAGACGTCACTTTTCCG
GGTCATGCGTAACTTCAAAAgccacggaggaggaggaggcagctcAACTGGTACAGGAGGTGAAACGAGTTCAAGCTCAGATGCTCCCACTTCATCGTCG
TGGACTTCGACACCTCCGCATCCATGGTTTTCAGAGGCTCAGATACGTTCCATTATGTACCAACTCTTCAGTGGGCTGGCGTACATGCACAAGCACGGCT
ACTTTCACCGCGACATCAAGCCCGAGAACTTGCTGTGCAACGATGATACACTGAAAATCGCAGACCTGGGGCAAGCTCGCGAGATCCGATCACGACCGCC
GTTCACGGACTACGTTTCAACGCGATGGTACCGAGCACCAGAGCTGTTACTTCGCTCAACGACGTATAACAGCCCTATCGACATGTGGGCCTGCGGTTGT
ATCTTGGTCGAGCTGCTGATTTGTACGCCGCTGTTTCCTGGGACATCGGAGGCTGATCAATTTTATCGCATCTGCAAGGTTCTTGGCACGCCCACGAAGG
AGTCGTGGCCCGAGGGAGCAGCAATGGCCTCTCACATGCAAGTACGATTCCCCAAATGTGCTCCTGTGTCATGGAAACGATTTCTTCCTCCAGGCACACC
ATCCGCGGTTGTCCAACTCGTGCAAGACCTACTGCAGTATGACCCAAGTCGACGAATTACAGCGGCGCAGGCACTTCAGCACTGCGTTTTTGATCAGACC
GTGACCCGACCAACATTAACAATTCCTCCGTTGGTGATGCCGGAGGAAGAAGTGCCTGTGCTACCACTCCGGAGTGAGTACAAGTCTGTAGGGGGATACT
CAAGCTATGCTGGTCGATCCAGTCTCTGTGTGAAAAGGCTGGAGGAGGTTCCAGCAAGTGCTGTGGAAACTTCGGGCCATTGGGCCGGAGGTGGCGGATT
GTCATCGCGACAAGAACACCATTTGTGGACTGCCAAAGAGCGGCAACAAACGCACACACGGCACCAGGAATGGGGCTCTTCACTTGTCAGCGCTCGTCCA
GGAGGATACGACGAGGTGGTAGACGCGAAAGGTGTCGCGTCAATTCAGAGTAGTGGAGGATCGTTCAAAGGGGGCTCAGTGAGAAAGAGCTCCAGCTACA
ACACGCTTGTGAGCGAAAGCACTAATGACAGCAGTCTTTATTCCTCGAGGAAATGCACATCCgacgacaacagcgacgacatcgacggCCAAGACGTCAA
GAGCGACAACACTCTATTGCAAGACTTGCTTGACGAGATTCTAGATTGAGCAAAATACGAAGACAATTCAGGTTTGGTGATAATTTCATCAGGTATATTG
TTCTTCTCGACGCGTTCCGTCGCACATCACACTGCTACACAGGATAGCAAGAGCGCACTTAGAACTTGAGGGCGTGGGCACGGTCGCTCTTGGTCAGCGT
GAACTTGGCGTTCAGGTAGGCCTTGAGGAACGGCTCGGCGccgagcttcttgatcagAGCCGAGTCCACGGCCTTCTGgtccttcttgcgctgctccgAG
ATGACAGGGGCCTGAGAAAAATAACGTCACCACGGTCAGTGTCTTTATAGGGAGCTTATGTGCCGAAGCAAGCGATCCCAAGCGCTCATATGGTGTGGCA
GGGAGCAATGTCTAaagacgtcgacgctccCCGCCTGATCCGCCACGCAAAAAGAGGTGCAGCAACGGTAAAAGCAAGAGAGACCCCAAAGGGTTCGTCA
ATCTCATTCTCCCGTCACAGCACCGCCTCATTGCTAGATGTGGAGGGATCGTGTGTAGTGGACTCAAAGAACCGACCAACCGGAGCGGGATGCTCACAAG
GGATACCAGCAATACAAAAGTAGAAAGGAAACTTACGGCGCTCGACTGGGCGAAGAACTGCTCctccttgctcttcttggcagccttctccttggcaAAG
TAGGCGTCGTCGATGGCAGGGAGCTCCAGGCCCTCAATGTTCACCTTGGTCGACGTGGCAATCACGTACGACTGGTTCACGCGACGGAGCGGCACGCCGT
TGACCTTGTACGGGCCTGCAATTAAGGGTGCAATAAAACTGTCAGTAAACGTACAAAACAACCCTCTCTCATGTATCAAACTATCTAGAGCCGGCATTCC
TCAGGTCTCATAATCTGATGGATCTTCGGCAAAAAGTCACCCCTCCTCATCCGAACATACTTCCATAACCTCTGTACAACGCGGGCCTACCTCCTCCCTA
TCTCACACAAAGGTGCTACGGAAGGATGTCGGCCACGTTCCACGAGACGTAAGAGCATGAACAGACAGAGGTGGGGACGGCAGAGCGCCTCTCGAAGTGT
CAAGTTTTGCATCATTGGAATGCCGTCTCCACACCAAAAATTGTGTCTGCAGAAGATGCTTACcagtgacgagcagcaggccTGAAGCCAGCTGGTTCAG
GAAGACCACGCGCTTGCCACGGAAGCGACCCGAGAGCAGGATCAGGACCGTGCCGGGGGTGATCGacttgcgcagcttggcggtcttgacgctgttgcgc
ttggtcttggccGACGGCAGCGGCTTCGGGATGTAGTCAGCAGGGTACCACTTCTTGGTGGAgggcttcttggcggcgacgaccttcttctcgccgcCCT
TCTTGACCATCTTGCCACGgccgttcttcttggaaAGGCTGTTGCGCGAGATGGCGTTGATGCCACGGGCGAGGACGACGTTCACAGTCTTGGAAGCGGG
CATGGTGATGAATATACCTGTGAGGAGGGAGAGTGGATGGAAGGTTAGGGATCTCGTGGTGTACGCTACGACGTCATGACATTCGCGCCTTACCTGTCTG
AAAAGAACTGAGCGGTAGGAAGAGCGGATGGCGTCGAGAGCAAACCACAGCCAACCACAAAGGTTGAGGTGTTCAACACAAACTGGATGGTACCATGTAC
CG