Description :
From Genome Similarity Track
Location :
Scaffold_198:104244- 108151
Sequence
3907 bases(100 bases per row)
GCGGCGAAAGCAGCCGGCGTTTTATTGAAATGTCGTCGATCCCTGTGTCGAATGCACGATCTTGAAGTTCATCGGCAATAGTGTGACAATGTTCATAACA
TCACGTAAGTGTGAAATTTTGGGTGAGCGTCTCCCGGTCAAGTGTTGTATGATGAGTTGGCTACTGCCAACGACGTGACCATTGTATAAATGGTATGCGT
AGTCCTACCAGTAGACCACTGTAGCCCGCGTGATTTTTCGTGTTTGTCTTGGCTGCATATAGAGTGCCATTATAAGCAAAAGGGCAGCTTGATGCAATGC
CCGTGATTGCGAATGGGCGTATTTCTGCTGATGGGTGATTTGGTGGCTCCTTGGTGGAGTCTCAAGTGCAGCAATAGGGGGCACGTTATCTGTTATTATG
CAAGTGAGGGGATTGGCACCTGCACCGTCGCCTCCGTATCGCTTGAATCGTCCGTAATATCCCAAGCCTCCAAAGTTATTGATACATCCGGTCAGTGATA
ACTCCCAGCGTTTGGGGGGCGAGTGTCCGTATTTTTTTATGATCGCCCATACCCCTGGAGGTACCGAAGATAGTTTCATTCCCAGAAGGTGCGGTGCTAT
CGTACTCGAATCATCTCTACCTAACGTCTTCCACGGTCGGAGAAAGGTATCCCATAGTGGTTGGGCTTCGTTGCAAGTCACGAATGAATGGAATATGCCT
GAAGCGGGTATGGCATCCGGTCGATTAAGATACACGCATGAATAGCCACGGCTTATACGAGCACTGTGTCTGATGTTGTTGTCTCCGAGCTCGAGCGATT
GTCTCTTGGATCAGCCTTTTGGGCTCAGTAGCTGGATGCAGTTGTACTTGTACGAGCGAGCCGTCAGTATAGCTGTGTATCGTAGATGACTTGATCGAAC
CGTTATCCTACTCTGAGTGGAAAGAGTGCGGCCGTGCGACGTGCCTTCGACATGCACATGATCATTAAATTCAATCATAGCAAGGTGCTCTGGACTGACC
AGAAACATTTGGTCCGCACGTGTATTCACGGAGAAAGCAATAGAGTCTCACAAGTGTCGAGGGTAAGTTTGAAAGCATGAAATATATCGATAGCTTCCTC
AGGTCAGCTTCCCACCAGACGTCCAGGTAAATAGCGACAGACCGTTGAACCATTAGTCAGCTTACCACGGTACTGTTCAGCGCACTCGTGAACACTCCCG
CTATCAAGGCTACCACTAATTGACTCTACACCAACTCATCGCCCAGAATATGCGCTCACATTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTCGCCCAGAATATGCGCTGACATTAGCTATATAATGTACGACCAACGTAACGCGTTTCTTCGGGTTCGCTAGCACTG
ACGACTTGATTGCGTTGAAGCTCTGGCACTATACCTGCTTTTAAATGGGACAGAACTGGCTTTTTGCTTTGGGATCCCAAGATACACTCACATCTGTGCA
TCACAGGGTCGGGCATATTGACATGAATGAAGGCAATAGCTACTGTCAATATGCAGACTGCAAAAAAGGATACGTTCATTGTGGACGCCGGCTGTGTTTC
TACAGCACAGAAACGTCAAAGACGAACTCTGACACCGGCCGAGCGGAGCACACGAATGATGTCTTAAGAAATCGCCGTGCGTAGAGCTTCTACGAACGTT
GTCACTCGAAGCGGTCAGCTTCGTTTCTTCGTCGAGCTAAAGAGGATGTTCGCGGTACACGTGCTCAGTAAGATGCCGCTCGTTTTTGTAAGACATCGTA
GGTGTGACTCTATATCCGATCGATGCAGCATTAACACAGGGATACCATGTTGGTCCTGTTTGTCCCGCGACAAGCACATCATCGCGAAAACATTGTGTCG
ACACTATTTCGGTGGGAGAATACAGCACCGATATGCACGTACTTTCAAGGCTAACTTAAACTCCCATCTGTGTCTCTTGGTCTGACCTTACGATGAAGAT
GAGCTTGATACGACATGCAATGTATTCCAAACGCACAAGGTATTCTTACGCGAGTAGCTGCTAGCTCTGTCGACATGCGGCACGGATGACACCGGTTGTA
AAGTAAGGGCAGCAAGATGACAGCGTCTTCTACATGAAGTAGATTGGATGCAGACTGGGCGGTTCTTCGTCTTTATGATCGTATCCTCCAACGGACTCAG
GTAAAGAGTCGAGAGTACAGGAGGAACCTTCTTTGCGTCCGAGTTGTCTTTACTGAATCGAATGTAAACTGGATGTCTTCCGGCTTAATGAACACGAAAG
GTAGACCAGAGGAGGTCGTAAACATCTCAAATCTCGGTGAGGAAGGCCACCTGCAGAAAAAGTCACGACGTGTAATCAACGGATGAGTCTATCAGCCAGA
ACCTCAACTGGAATCTTTCGTTTCGCGTTCCCCGCAGCTAAATGTAGTTTCTTTGCCTAGCCCAGAGGAACGCTATCGAATTCTCTGGCTTACACTGCAG
GATCACC