Description :
From Genome Similarity Track
Location :
Scaffold_112:10423- 16212
Transcript NameFunction/comments
Hyaar_Emoy2809876predicted protein

Sequence
5789 bases(100 bases per row)
CGTTGGGGTGCAAGCTGAACCGTAGCACGACGCTCAAAAACGTCAACGGCGTACGGTCAATCTTGCCGATAGGGTACCTCAAACCCATGAGTTCTCAGAC
TCAGGGTATCCACGCCACTTCACCGGATACTGATATTGACCTTTGCGACGATGCCGCTTCAGGAGCTTCTCCACATGGAGCTGCAAGTTCCCTTGCTTGT
CTAGAAACGTAGTAGGGGGTCGGTGTGTCAGTACAGGTGCATGAAGACTTGGTGTCAGAGGTGGTGCGACTTCGCGAGTCTTTCGCTCACGTGCAGAGTG
CACTGGATCATTCTGTGAATGAGAGGAAACAACTATGGGAGATCCTCGACAAGTGCAACGCGCTCGTGAACAGTCATCGACTGAGTTTGCTCAGTTGCCT
GAGCAAATGAACCGTCTCTGCTCGATCGACTCGGTCAAGAAACGACGCCAGAAGGTGGAGTATAACCTGCCTCGACTGGGTGGCCAGTTGGAACTTATGA
CGGAGATGCATGTAACAGGGACGACGTCCCTCCTTCAGGCGCAAGCACCTTCCAATCTGCGAGAGAAGGATCATGATATGGATTAAGCAAGAAAACGTAA
AACATTGGGTGTGTACGCAACTTGCGCGGAAGATTGAGTGTATAGGCAATGCCCTTCTTTGCTATGACCTTGAACGGCCCGACAAGCGTGGGCGCAACTT
TGTCTTGAACACGGAAGACACTACATTTGTAGGTAGGTCTTTAGCATTTAGTAAGACTTGGTCTCCAACTTCATAAGAATCAATACATCCTATGCCTTTA
GCATCAGCTTTTTCTTTTTGTTTGTCCTGGCTATTAGCCATTGCATCATGCACGCTTCGTAAGACACTAAAGTGTGTCGCGAGAAACTCGCTCACTTGTT
TCTGCATTGGCTTAGGGCTGATTTCAGCAAGCTTGTCAGCAGACTATCCCCCACCAAGCCCAGAACCACGGAGTGGTAACGTGAGCGCAACGCGGGGGTG
CGTGAGGCTATTCATATAGAAGGGAGTAAAGCCGGTCGTGGCATGGACAGCGTTTTTCAACACGAATTAAATGACGGGGAGCACCGAGCTCCAAGTCCGT
GGCGACCCAGAACAAAAACTACGAAGAACATTGCCGATGACGCAATCAACTCGCTCAACTTGACCATCGGTCTGCGGATGATCCGCTGTGGACATGTCCA
ATCGCGTACCAAGAACCGTGAAGGTGGAAGTCTAAAATTTGCTGGTAAAGCGAGGGTCGCGATCAGAGATGATTTCCAGTGGCAACCCCTGTTGACGAAA
CACACGATCGATAAAAGCATAGCTGTACCTTTGCCATCGATTAAACCTGGCAGTGCCGCTAAGTGAGCCATCTTGTTCAAGCGGTCAACAAATATCACAA
TTAATGTGTTGCAGTCATAGTCCTTGGGAAATCCCAAACACAAAATCCTTACTGATGGACTCCCAACACCCGGTGGGCTCAGGTAAACTGGCGAATGTCG
CAGCCGAATGTGCCGAAGGTTTGACCCGCTGGCACGTTTTGCATGTACACGTATGTGCTCACCCATTTGTAGAGTTTGGGTCACCAGTAGTGTTGACTCA
CAGAGCCATAGGTCTTTTACCAGCCCAAATGCCCACTGACGGCGGTATCGTGGGCCTCAAAGAGGATTCGATATTTAAATTCTCATCGTGAGCTACAAAA
ATGCGAGCGGTATCCTCTACATCTGTGCGATAGCACAAGAGACCATTATCGATGGAATATCGATGTAGGCTGGCTCGCAAACGTGCCGATAAATTACTGT
CCGAGTCATCTTACTTCTCACTCCCAAGGGCATAAACCATGCCACACATTGAGAATCCCGTGGATATGCCACTCGAATTTACTCCTCAATAGGAGACGAC
AGAGTCGTGACATGAGCAAGCTCATAATCGGGACAGCGAGAAAAATAGGTCGTCTGTTAACACATTTTGTTTCCGTGGCTTATACTTCACCTCGAAGTTA
TATTCCGCAAAGTAGGAAAGCCAGCGAGCCATTCTCTGAGAGAGGTGAGGCGACTGTGTCGCCGTGAATAATGACGCATGATCCGTATAGATTACGAATG
GCTTGGAGCCAAGCAGATGGAATCTAGATTTGACGAGAGCATACTTCATACCAAGTATCTCTCTGTCATGAACTGGATAGTTCTTTTCAGCAGCTTTCAG
CTGACGAGATTCAAATGCGATAACTCACTCGCGGCCTGCAGCATCTGTCTGTAACAGGGCGCTGCCTATAGCAAAATCGGATGCATCGCAGACAACGCTA
AAAGGGTACTCAGGATTTGGCAACGCCAAAATGGGAGCATGGAGGAGACTCTCCTTTACTGCCCGAAATGCGTCATCATGGGTCTTTCCCCAGTGCCAAT
CTGTGTCCTTCTTAAGGAGGTCAGTTAATGGCCAGGCCATATCAGCGTAATTTTCACTGTGTTTGTGTAAGTAATTGGCAAGGCCAAGCCACTTACGCAA
GTCCTTAGGAATCGGCCAGTCCACTATAGCCTGGACCTTAGCTGTATCCGCTCTAATGCCGCGCTTACCAATGAAACATCCTAGAAAGGAATCTCCTCTG
CACCAAAAATGCATTTAGACGCGTTGGCGGACAATTTATTAGTGCGCATGCACTCGAGCACGGCTCGCAAATAAATGATGTGATTTTCAACATCTGACCG
ACCTTTTTCGGCACGACTATGGACAAAAATGTTATCAAAGTACGTCTGTGCGTAATCCCGATGAGGGCGGAAAAGTTGCGTCACCAGACGATTAAATGTT
GCCAGATCATTAGACAGTCCTTGGGAATCACCAGCCATTCCCATAGCATACCACTCGGGGTGCTCACTGCTGTAAGCGGAATATCACCTGCTCGCATGAG
CAATTGATAATATCCATCAACCAAGTCGAGTGCGCTATACATAGTACAACCAACCATGTTGTTTTGAAGAACATTCTTTCGAGGAATTGGTGTCTGTACC
GGAATAGTAGCCGCATTAAGCTTGTTATAAGCATGCACAATACGCCACTTACCGTTCGGCTTTTTGACACAAAATGTCGGTGTCGAATGTAAAGATTTAC
TCTCACGAACCATTCCTGCCTCGTGCTTAACACGAAAGAAGTCATCACTGACATCACATTGCTCCATAGGCAAAGGCCAATGTCGTGCGGCACAATATTT
AGTCCCAGGAACTAAGTCAATTTCATGACGGACACCTCTATCTGGAGGTAAAACAGAGGGTGGGGCGTGGCACCCTGCATCTTGAAATTCCTTGACTAAG
GGGGTTAAAGGGATCATGAGGATTTATCAATATTTATGACCCAATATGCGCACTGAGTGCTGCTTTTGTGTCCTCCAGAAAGGCTTCATCCAAAAGTAAA
GACGAGTTCAACTCTATGATGTCGGGTCGAATGACCACCACCTCTAAAAGGTCTCCATTCGTTAGTAAGTGATCAAACTCATCAACCGACAACTATTCGA
GTTCTAAAAGCGAAGTTAAAGAGGGTATAGCCTTAAGGATAATTGTACCATCACAGGCACCAGTCACTCCGTTGAAGAGTGTATACAGATGACAGTCATC
ATCACTTTGTGACACAGCAAACGATGTGTGATTCGTATCTCTCTGATCAATACCATCGTCGAACTTAATTTGCTCTAAACTAGAGCTGACGCCACTATTG
ACGTCCGATGACTAGTCATTGGACATGATGTCGTCATCACGTGGATCACGTACCACTTCACGTGCATCTGCTGAGCCGGGCTCGGGATGTTTTGGTATTT
CACCAACAACGTCAATATTGACATTGAGCGCGTCGCTATCACAGCCAACGTCAGTACTTACAGTACTTACGTGCCATTTCGCGCTCATCTGATGGTTTCA
ACCCTCGATGACTTAACGCTTGGTCAACAATGCTTTCAGCATTCAGTACGTTGCTCTCACAACGACTATCACTTAGCGGAGTACGTGCCGCTTCACTATC
ACATATCGAGCTTTGCTTTATACTCATGTCTTTGAAATCGTCAGAATCAACTAACTCCGACATTCCGATTCCAGCACACTGACATTGTCAGCCAGTGGCT
TGCGCCCATAACGCTTCTGATTCCTAGCAGAGGTGGTTCATGACTCTCCAAAGCTCCGCTAGGGACGGTGCGCGTGGCGCCTAATGTTTTCGACCTCCAG
TCGATTCATGGTACATGGCGCTCAATCCAAGCCATACCAAGAATGAGATCATATCTCGAGTCCAAATTAAGGACTAAACAGAGTTCGGTACTATCAAAAT
CAAAAAAACTTCACACCCAAGCTCACAGGAACTTTGGGTGCATTGACTAGAGTTCCTGTCGCCAAGCGAACAGTGATCGTATCACCCCCGTGCGCTTCTA
GCGCCCCAAAATAACGTGGATTCCCCTTAAGGGAACAGCATCTGACATAATAAACGGATGATCTGGAGTCGATAAAAATCGACCAGGGTTTGTCAAAGCC
CTTAATAGTTGCCTTTGCAACCAACAAGCCTGGCTTGTATTCACGCCCCGTGTTAGAGTGCACGGGACTCCTTGGGGCTAGGTTCTGCTCGCTTCTACCT
CCTAGAGACTCAACAGAACCTAGTTCCTCCCCAGCAGGGCGCTCTGCGCCTACTTGTAGTATAAGTTTCCCGCACCGTACCAGACTTCTAGTTAGCGGCG
GGAGTTTGGCTTGAACTAGCCTGGCGGGCCCTGCGTAAAGAGCAATTAGGTTGCAGATGCTTTGTGCTTCCGCACGTGAAACATCGTCGAATGTTTCGAT
GATGTTCTACAGCTTGAAGCTCTGCTTCCTCGTCCGTCTTGGCGAGACTGAGGTACATATGCTCCGGCCTATTTAATGAACTAAATGAGTTCACCGAGTT
TGGGTTGTACCCATGAGTGCCAAAACGGTCTGCCTTAAAGTTGAACTCAGCGTTCAACGCGATATCCACAGCCTCCTCAAAGGAGGTGGGGTGTACCCGT
AACACTTCCGTTTGAGCCACGCCCGTGCGAAGACCCTCCATGAAGATGGTAACCAAAACCATTTCTGGTATGGGATCAAGCTGCATGGCAGCGATTAGAG
TTCTCAGTTTCTGGAATGATTCCGATAGTTCTTTCTTGCCCTGACAGGCAGATAATAAATGAGAACGCACTCGGGATGCCTGATTAGGCGGATCAAACAC
TCGGGATATTTGCTGTTTTAGCAAGTCCCATGTGGTGAAAGCTTCGTCCACCGACGTGCTACACGTGAGAGCCCATTCTCTAGCTCGACCACCTAGTTTC
GAGATAGCCATTCCAACTCGCTGTTGCTCCGACCAGAGCATAGCGGAGTTCATGGCCATTTCCACCTCTCTGATCCACAGAAGGATGTTCTCCCCTTCTT
TTCCCTCAAATGTCTTTACAGTCAAGACAGGGGGCGAGCCCTTGGCTCTTCATCGGGTATGGGGACATACCGAGTAGGCGTAGCCGATGCCAAATGGTCG
TGTACTTGCCTAAGCAGAGTGGACTCAAACGGAATAAAAGCGTCAAGACGTGCACGAACCACTCCAGGACCTTGTGCAAGGATTAGATCCACATGTTCAT
TCCCGACTAGCACTCTGAGTTTCTCCAGCGCTAATCCTTGGGCCTCACAGAGGGTTATCTTTGTTTCAATCCTTACAGAAGAACAGTCTTTAACATACTC
AGGTTTAGATTGACTACAAGGTCTACCAAATGTCGCGGAGCTACCTTAACTACCTAGTCAGACGAAGACTTCTAGACTCGTAGAGTCTC