Description :
From Genome Similarity Track
Location :
Scaffold_2:1042148- 1048765
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000806Similar to Putative ankyrin repeat domain-containing protein LOC554226 (Homo sapiens)
Pytul_DAOMBR144PYU1_G000805Protein of unknown function
Pytul_DAOMBR144PYU1_G000804Similar to hisS: Histidyl-tRNA synthetase (Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / PAl5))

Sequence
6617 bases(100 bases per row)
CCGTTTGTTCCGCTCGCGCCGCCAAAGAACTGGCGCACGATGGCGCTCCGATCGAATGGGAAAATCAACCGCATCGTGCAGGCGGCGCTCTTGAAGACGC
TACTCCATGCGATCCGAAGAGGATCGGCGGAAGGTGTGCGCGTCGCCATTGAGCGAGGCGTGGTGACGCAGTATATCGACAACCGTGGCCGAAATCTGGT
CATGTAAGTGGAGAGACAGGCAAACTTGCTGATATGAACCTGCAGTTAGTCTAATTTCGTGTTGTTTGCTGTCTGCTGCTTGAATAGGCTTGCTGCGAAG
TGTGATACAGATGCGCGCTTGCAGATTGCGATCATCTTGTCCGACGCGGGCTGCGATATCAATCACACGGACCAATTGGGATGGAGCTGCTTGCATTACG
CTTGGTAAGCGCTCTTTGGTCGTGATTTTGGCCCCGTTACCCAGACTCACAGTGATTTTCTTTCTTGCATGCAGTGCCAGCGGAGCGCTTGACGTAGCAA
CTGAACTGATTCGACGGTAAGACGCCAGGCTAAATACGTGAAAAAAATTGCATGGTGATAAGTGCTAATCGCTGATTCTTGTTTCATGTGCAATGCAGAG
GTGCTCGAGTGGAATACAATCCATATGGCTACGGTCCAGAAGATTTCATTATCCCCAAGGTCGCCCGCGCCAAGAGTCTATTGCAGCACACGGAACAGCT
TCAGCACGAAGCGAGTGTCAAGTCTTGCTGGGACTTTTTCCGCAAACACGCAAAGAAGACGGGATACAGCGTGAAATGCCGCTCAGTACGATGTTCTACC
TTGCTGCACTGAGTCGCTAATCCTGCACAGACTAACGACGGATTTTGTTGGCATTGATAGCATTGTGACTTAGGCAAGCCTCTGAAGATCAGCTTTGAAG
CTCCACCTGGCCACAGCTCGCTGGATCGAATTCGTGTCATTGATATGAATTCGGAGGTCTCTCTGTGGCTCCAAGTGTCCAAGAACTTCAGCATCCCACC
TGGAGATGTTGGCTCGATCACTATCGACTCCGAGACTCTCGATCGTCCTTCGCTCTACAGAATATTCTATGAAAAGTATGAGCCTACTCCTATCAAGCTG
CCCGCTGAAGTCGCAGAGAACAACTTCAGCATCAAGAACTTGGACACTGGAACCACTGTGTCGGTGGGAAGCGTGAACGAACTGGTTTTGCGAGAGCTGA
GCAGCACACGCAATGCTAAGAAGTCGAAGGGTTTGTCCAACTCATCGAGGTAAGACCGTTGCTTGCTCATAAAGGAAGATTGGTTTGGTGGTTGACTAAC
GCTCCATACATTTACATTTACAGGGAAGCGCCAGTCACCCAGAAGAGCACGATGCCGCGCAGGATGTCGACAACGAGATTCCGTGAGCTTGCTGAAACCG
AACGAGAGTCAGGCGAGGAAGCAGAGGAAGCCGAATTTGCGGCCGAAGAGACGATCACAATGACTGAGATCGCCGAGCACCCAGCTGTCACCAGTATCAC
TGGCGTCTACAAGATTGTGGGCATGGCGATCGTCAGTGTCTCCACGTTGAAGCGCGTGAAAGCAAATGAATATGAAATTGTCATCAAAAGCAGTGGCACG
ATGGGTCTTCACCTGGTAAGATTGGCTGGTTGCTTGTGATATTTGCTTATGTTACAATGCTGACTCTCTGGTTGTACTAATCTTGTAGGAACCAAAACGA
GACAAGTCAAACAGATCCACTAAGCTTATCGTTCGCCGCAGTTCTGGTCAGACTGCTGCGGTGAATCCCGGTGATTGCTTGGTGGCGATCGGACGAGCCA
ACATCGAGCATGCCGGACTGAAGCATACCTTGTGGGAGCTCAACGCATCGAAGCGACCACTTGTTCTTCGGTTCCGTCGAGGAAATGTGAAGGAGAAGAA
AAGCTTGTTCACCAGCATTCGCAATCTCTCTGGCCCAAAGCCGCAAGCCGCCATCGCTGTGTAATGCTGGTGCGACCAATTGAAACAAATAGTAGATTAG
GAGAAACGAGAGAAACGTGGTGGATTTGTGTTGCTTGCAGGATGAAGAAGAAGGAAAGTGGTAGACACGATAGCGAAAGCACTTCTACTGATGACGTTGT
GACAGCAAAAAGTATTGTTAACTTGGTGAATCAAATGACGAAGAAAGAAGAAAAGTATGTGTGATGCATGCATGAGGGTACATTTTGCTGACTGAGCCGT
TATACACATACACTAAAAAATGCCTAGAGCATGGGGTGTCCTTTTTCCAAGTGACAGTAATGGAACGATTTGCCTCGACGTGCGCAGAACCCACAGACCG
TCCGAGGAGTCGAGCACACGTCAATCACATGAGCTGGGTTTTGCTGTGGTTGAGCATGGAGAACAATAAAACATCAGTCAGCGTCAAGGTGTGGGTGGGT
ATGTCGTAGGCCACACTCAAAGCAGCCATCCCTACCTTGAAATGCTCCAGTAGGTCATCTGGGTGGACCTGCATGGTCGTGTCGTGCTCTGAGTCGTACA
CATCCACCGGCACTATCGTCATACAAATTACACGCACAACCGAGTCCATTAACGTTACTTCATTCAATCTGCAAGCAGCGACAAGCCATGCACGTACCAG
CTTGGCCCTTTGCCCGCCACGCATACCAGACCTGGGCTTCCCACCAGGCTGGTTCTTCAGACCCGGCATTTTGATACTAATTCGTTTCGCAACCATCACC
ATGTCAGTATGAACATCAACACCACTATAATGAACAATGTCGTGGCGTGGTTGCATGACAACAGGACATACCGCAACAGCGACAAAGGATCCTGGCCGAA
GCGTCATCGCCCATTCCTTCACTTGAAATCCGAACGCCTTTGACGCGCGGCCTCGCTTGTAAGAATCTTTCAGCAGCCACTCGCCGCCTTTGCCGTTAGC
GCGCCGCCGGATCCATGGCTCATGCTGATGGAACTTCCATGTGTTGGGCAGAATCACCTGCGCCGGGTCGTTCGGGTCAAACGAAACCACGCCAAAGGTC
CAGTGCGCGAACTCGTGCCGCATCTGGGCCGTCTTGTACCCCGTGTAATACACGAGTATTTGATACACCTGCATGCACAATAGGAGATTGTAATGCCAGA
CAGCAACATGTTGGTTACAAAGTGCTTTTACAGACGGCATTGTTTCTCACGACAGCGCACAAGGAACAGTAATGCAATGAACGTACGCAGTTCATCTGGA
GGTGGAGGTATCGCGCCCAACTCTCTCCGCTTCGCTTTGTGTCTTTCAGGATGATCTCTGTCCGCGACGGCGCCGACACGAACTCCCGCGTGCCACGCTC
CGCTACTGTCTCCATATCCGCTTTCATCGTGCGGCTCACCTACAACTGCAAGTGTTAATGAACAGCATTGTCTAACAAAGCATGAGCTCATAGGGTCGTA
CCATGCTGAGCTTTGCGATATCCACTGGGAGCAAGCACGCCGCAATCATTTGCTTCACTTCAATGTCAAACAACTGCAGATTCGTGACGACGCGGTAGTG
CGGTCTCCGACTCGCGGCCGTCTTCTTCTTCTTGGGCGGCGTCAGTTGCACCTCTGCCTTCACGACGGCCACCGCCGTTCGGCGGCGCGTCTTCGCTCCG
GCCATGGCCTCCATCTCCTTTGCGGCTAGCGCTTCGACATCGGCTTGCGATGGCGCCTGAACAGCAGCACCATCTTTCTCTTCGACGACCGCCTTGATCC
GCTTCTTCTTGCTTGCGAGGTTCTTCTGGAAGTACGCGCTCTGGAGACGCAGAAAGCAGGAGCAGATCTCGCGCTTGTTGCAGCTGCGCGTGTGGATCAT
CTTCTGCGTGCTCTCCGCAGGCAGCGCATCCACAGAGCCACGCGCCGGCGCCATCTCTTGTTGCTGTTGCAACGACGGCTCCATGTTGCTGACAAAATAG
ACTGGCGTAAAGTATGGGACGAGCGAATGGGTTGGAGCCGACCTGTTTGCTAGTTGGAATCCGGCTGGGTCTTGGTCACACGCTGCTAAGTTCGCAAGGA
AAAGCATTTTGTATGCAAGTACGCACGTACTTTAGCTTATGCGTATTTAACATTGGATACGCGCATAGGTTTGGTTCGCATGTTAATGAATCCGGTTAAA
TTCGTGTTGGTTTGACTATGGTAGGTTCGCATTTCGGCAATCCGGTTAAGTTTGGTTGTCAGCTCTTTGGTTCGCAAATTGCCAACATTTTCTGATGGCA
GCAAAAATGTGGGCGGCATCATCCTCGGCGTCGCGGTCGTGGCGACGCGCTGCAACTGCTGCGGTCTGTGGACGCGAGCGCGTCGCATGCTTCGCGTCTG
CTGCTGCAACTGATGGCGCGAGCAAAGCGAAGGTCACGGCCGTCAGTCGTGTGCGCGGCACGCGCGATTTGCTCGCTGACGACGCCGCGCAGCACCAGCA
AGTGCTCCACGTGCTGCAGCAGACCGTCGGATGCTACGGGTTCCGACCGGTGCGCTAACAGTGATCTCTGCTGTGCAAATGCGTTTTGGAGATAGTATTG
ACGTGGATATATGTGTATGCCAATTGCGCTTTTGTAGATCCAAACGCCGCTGCTCGAGTACACGGATCTGTTTTCACGCTCGCTTGGTGACGGCTCAGAC
ATCGTCATGAAGGTTTGTTGCACACCGTCATCTTGATGGTGATGGCTGCTGCAGAATGGTGAAACGCACAAAAGAAAGGGTTTCAAAGCATTCTCTGTGT
GTGTATGCATGGAACGATAGGAAATGTACACGTTTAAGGACAATTCGAGCAAGAGCGTGACGTTGCGACCGGAAGGCACTGCAGGTTGGGTACTTTGCCG
CCCTTATAGGCATTTTGGACTAGTCTTGCTCCCATTTCCCTTTCTATGTTTAGTACTCATCCGCTTTTGCGTCATGTGCTATGGCTGTAGGCATTATTCG
TGCGCTGCTGAGCAACAATCTGATGTTTTCGCTCCCGCAAAAGGTGACATACGCTGGGAGTATGTTCAGGTATGTGATCTTTATCACCTCAGTATGCTTG
GCTAAGTGCACCATAAGACTCGGTCCGCTTACATTTCAATGTCCCGGAAAAATGCCCAGATACGAGCGTCCTCAGCGTGGTCGATACCGCGAGTTCCAGC
AATTCGGTACGGCGAATAATGTGCTGGTACAACCGTGACACATCGCACCAAATGCTCTAATCCGACAGATGTATTGTGCATGTGTTGCGCGTTGCAGGTG
TGGAGTTTGTCGGGTCGTCCGGACCATCTGTCGACGTTGAAGTACGCTCACGTTTCTCTTTTGAGCGCGGCATTGCGATATTTTACCACCAAGCAATCTG
CTGACGGCCTTTCGGGCGTGTTTGGTTGTCTACAGGTGATCGCGATGGCTGCGGATGCACTGCAAGCGTTGGGCATCCGACACAAAGCCATGCTGGAGCT
CAACACGCTCGGGGACGCGGAAAGGTAATGCTAATTTAACACATCGACTCTGGCATCGCACACATACGTGACGCTTTTGTATTTCGTGTAATTTTGATGC
CTCTTTTAATAGTCGTGGACGCTACCGCGTTGCCCTGGAGGAATTCTTTTCTCAATACAAGCACGAACTCTCCCCGGACAGCATCAACCGGTACGTTTTG
TCTCTACTCATTGCCTCTCCTTTGTTCATGTGCTCATCGAGTGGTTCTTTGTGTACTCTTTAGTCTGGAGCGTGGAAGTGTGTTGCGCATTCTCGATTCC
AAAAGCGAAGTCGACCAAAAGTTTGTCGCTGAGGCACCTCGTCTCGATGCATACTTGTCGAACGACGCGGCCCAGCGCTTTGACGCCGTGCTGAGCGGCC
TCGACGCGCTCGGCATCAAGTATCGCCACAACTCGCGTCTCGTTCGCGGACTGGTACGTTTGATAAGCAGCGATTATGTTGTTGTTGCTTTGTATCGTTT
CATGTTTTTTGTTATTAGAAAAGCTCATGATCAAATCACTATCTCTCTCTCTGTCGAAAAATCACAGGATTACTACAGTCACACTGTGTTCGAGTTTGTC
GAAAACCTGTCCGCCAATGTCGACGATGAACACGACGGAGAACCTGGAAGCGGAGGCATCGCAGTCCTGGCCGGTGGATGTTACGACAACCTCTCGGAGA
CGCTGGGTGGACCACCCGTATCGTGCATCGGCTGGGCAGCTGGAGTAGATCGACTCCATCTTCTTCGCGATATCGCCGTCGAGCCTCCAACGACAATCGC
GGTAGGTAGCGAAGCTGGCGTTTGCCTTATATTCGACTTTGTGTGCTGAGTAAAGCTGGTTGGTATGGGTCTGTAGGTAGTTCCAGTGCTCGTGGGTGAC
GACCAAGACGCTGTGCTCCACGAGTCGATGCAAGTAGCCCATGTACGTCCTTGTCCAAGAGGTATTACTGGTGTATGAACCGAAAACTGATCAACTCCTT
CTGCTTTGTAGACACTTCGCCAGCGAGGGCTGTCGGTGCACTTTTGTCACGGCCGAGGTAACCTCAAAAAGCAGATGAAGGCTGCGGAGAAGTTCGGCTG
CACCTACGCCGTGATCCTCGGAGGCGACGAGGTCAAGAACAAGTACGTCAAGGTGAAGAATCTCGAGAAACGGCAAGAGGAGACCGTGTCCTTGAACGAG
CTCCGTGGATTTGAATT