Description :
From Genome Similarity Track
Location :
contig_76:104203- 106244
Transcript NameFunction/comments
g12430.t1hypothetical protein

Sequence
2041 bases(100 bases per row)
ATGTTCAATGCACTGTACGTCGTTCATCTCCGTACGCACCCAGAGCCCCTACCACTGAGTGGTGACAGCAGTGGTCCAAGTGACGAGGAGAATAACGAAG
ATGCGCTGCTTGTGGATCAGGACGAGCAGCTAGTACCTGCTGCTGATGGCGACAGCTTTGCCTCTGCTGACGTATTGTTTAAGAAACGACAGCGCAAGAA
GTTTTTCCAGCATGGCATCCAAGAGTTCAACCGTAAACCATTGGCTGGAATCAAATATTTGCAGCAAAACACGTTCCTGCCTACACCACTCGACAGTATG
TCGCTTGCAACGTTCCTGCGATCCCTTCCGCAGGGCCTCAACAAGAATGCCGTGGGCATGTACTTGGGTGCGATGGGCAAGGAGGTCAAAGGGTTTGAGA
AAACCGAGATCCATGAGGCCGACACGATGGATTTCCACCGCGACGTCCTGACCAACTTCGTTAGATCATTTAACTTTGAGGGTGAGAGTATTGTTACCGC
GCTGCGGATGTTTCTCGCGAGCTTCCGCCTTCCTGGAGAGGCGCAGCAAATCGACCGCATCCTGAACACTTTCTCACTCCAAGTGTACGAACAGTGTCGT
GAACGGTTTCTCATGGCATCCGTAGATGTAGCGTATCTGCTGTCGTTCAGTCTGATTATGCTGAATACGGATCTGCACAACCCGAATATCCGATCCGACA
AGAAAATGAAGCTGATCGACTTCATCAAGAACAACAAAAACTATGGCCAGGAGGTTTCCAAGGGCCAAGATTTGCCTGAAGACTTCCTGACTGAGTTGTA
CAATACCATTGCGAAGGACGAGATTAAGACATTTGAAGACGGCGGTAAGCACGGCGAAGTGACAAGTGATCGATGGAAGGATTTACTCAACCAGGCAGAA
AGCAACCCTCGTAACTCGCGCTTGATCGTACATCACCCGTCGCTGCACCTCCGATCATCTAGCACTCCTCGCGGCGTTGGCGTCACGCAAAATGTGTCGT
CGCCTCTAGCTCCTGATGTCATGCGAACGATGAAACAAGCTCGGCTTACCAAGAGCGCTTCCAGTCCCGCTAATGGGTCTGCTGGTCTGTCCAAGAGGGG
AACGTGGGAGCAGCAGGATGGATTCGATGGACTGGTACCCCTTTATGGCTCTTCAGGCAACCAGTATGATCGCCATATCTTCGAGTTGCTTCAGCAAAGC
CTCGTACGAGCTTTTGGCAGTGTGTTCCAGCAGTTTGTCGTTGATTCACAGGCGAAGGACGCTGCACGAGGCGAGGACCTCTCTGTTGGCAGCAGCTATG
AGATGCACTATGTACCGCAGAAAAGTGCGCTCCAGCTTGCATGCAACGGTTTCGTATTGTGCACGGCAGTGGCATCTCATTTGTCGCTGGTGGAGCACTG
CAACGCACTGTTTATCCGCCTTTGCAAATACACGGCGCTGCTCTCGTCGGATATTTATCCCGTGGGATACAATGGTCGCGAAAACGGCATCTGGGTGTAT
TGCGACAACCAAAGTGCTCCCGTCGCGACAGCTGCTGTGCTGAAGCTCGTCAACACATGCAGTTTGTCCCTGCACAGTCGCTCGTGGAAGCATTTCTTCC
ATGTCGTGGGTGGTTTACGTGAATTTCATGTTCTGCCATCGCGTATTTTGTATCCGAGCGATGAAATGAACCTGGAGCTAATGACGTCCGACGAGCGTCT
AGAGTTTATTGACCTGGTGTACCAGAACAAGGAAGAACTGGAACGGACGATCGCGCTTAGCGCCCAAGATCAGGATGGTGGAAATGGCGATACTGGTGGC
TTCTTTAGTGGTGTTGCGTGGCTACTATCAGCCCTCGACTCGAATCTCGGCGGCTCGGCACCGGACTCATCGACACCAGCGAAGTCGCATCTTTCCCCTG
GTTTTGAGCAGTATCAGCTAAGCCCAGCAGAGTTAGCCTCGCACACGGAAGACCTTGTGATCGAGGGAACGACTCCGAACAAGCAGCCATCCGATGGCGA
GAATGACTCGAGAGGAGAGTTTGGAACGGATCGGTGGATTC