Description :
From Genome Similarity Track
Location :
contig_76:104201- 106279
Transcript NameFunction/comments
g11865.t1RAW40539.1 hypothetical protein PC110_g3263 [Phytophthora cactorum

Sequence
2078 bases(100 bases per row)
TCTTCGCGGAATGTTCAATGCACTGTACGTCGTTCATCTCCGTACGCACCCAGAGCCCCTACCACTGAGTGGTGACAGCAGTGGTCCAAGTGACGAGGAG
AATAACGAAGATGCGCTGCTTGTGGATCAGGACGAGCAGCTAGTACCTGCTGCTGATGGCGACAGCTTTGCCTCTGCTGACGTATTGTTTAAGAAACGAC
AGCGCAAGAAGTTTTTCCAGCATGGCATCCAAGAGTTCAACCGTAAACCATTGGCTGGAATCAAATATTTGCAGCAAAACACGTTCCTGCCTACACCACT
CGACAGTATGTCGCTTGCAACGTTCCTGCGATCCCTTCCGCAGGGCCTCAACAAGAATGCCGTGGGCATGTACTTGGGTGCGATGGGCAAGGAGGTCAAA
GGGTTTGAGAAAACCGAGATCCATGAGGCCGACACGATGGATTTCCACCGCGACGTCCTGACCAACTTCGTTAGATCATTTAACTTTGAGGGTGAGAGTA
TTGTTACCGCGCTGCGGATGTTTCTCGCGAGCTTCCGCCTTCCTGGAGAGGCGCAGCAAATCGACCGCATCCTGAACACTTTCTCACTCCAAGTGTACGA
ACAGTGTCGTGAACGGTTTCTCATGGCATCCGTAGATGTAGCGTATCTGCTGTCGTTCAGTCTGATTATGCTGAATACGGATCTGCACAACCCGAATATC
CGATCCGACAAGAAAATGAAGCTGATCGACTTCATCAAGAACAACAAAAACTATGGCCAGGAGGTTTCCAAGGGCCAAGATTTGCCTGAAGACTTCCTGA
CTGAGTTGTACAATACCATTGCGAAGGACGAGATTAAGACATTTGAAGACGGCGGTAAGCACGGCGAAGTGACAAGTGATCGATGGAAGGATTTACTCAA
CCAGGCAGAAAGCAACCCTCGTAACTCGCGCTTGATCGTACATCACCCGTCGCTGCACCTCCGATCATCTAGCACTCCTCGCGGCGTTGGCGTCACGCAA
AATGTGTCGTCGCCTCTAGCTCCTGATGTCATGCGAACGATGAAACAAGCTCGGCTTACCAAGAGCGCTTCCAGTCCCGCTAATGGGTCTGCTGGTCTGT
CCAAGAGGGGAACGTGGGAGCAGCAGGATGGATTCGATGGACTGGTACCCCTTTATGGCTCTTCAGGCAACCAGTATGATCGCCATATCTTCGAGTTGCT
TCAGCAAAGCCTCGTACGAGCTTTTGGCAGTGTGTTCCAGCAGTTCGTCGTTGATTCACAGGCGAAGGACGCTGCACGAGGCGAGGACCTCTCTGTTGGC
AGCAGCTATGAGATGCACTATGTACCGCAGAAAAGTGCGCTCCAGCTTGCATGCAACGGTTTCGTATTGTGCACGGCAGTGGCATCTCATTTGTCGCTGG
TGGAGCACTGCAACGCACTGTTTATCCGCCTTTGCAAATACACGGCGCTGCTCTCGTCGGATATTTATCCCGTGGGATACAATGGTCGCGAAAACGGCAT
CTGGGTGTATTGCGACAACCAAAGTGCTCCCGTCGCGACAGCTGCTGTGCTGAAGCTCGTCAACACATGCAGTTTGTCCCTGCACAGTCGCTCGTGGAAG
CATTTCTTCCATGTCATGGGTGGTTTACGTGAATTTCATGTTCTGCCATCGCGTATTTTGTATCCGAGCGATGAAATGAACCTGGAGCTAATGACGTCCG
ACGAGCGTCTAGAGTTTATTGACCTGGTGTACCAGAACAAGGAAGAACTGGAACGGACGATCGCGCTTAGCGCCCAAGATCAGGATGGTGGCAATGGCGA
TACTGGTGGCTTCTTTAGTGGTGTTGCGTGGCTACTATCAGCCCTCGACTCGAATCTCGGCGGCTCGGCACCGGACTCATCGACACCAGCGAAGTCGCAT
CTTTCCCCTGGTTTTGAGCAGTATCAGCTAAGCCCAGCAGAGTTAGCCTCGCACACGGAAGACCTTGTGATCGAGGGAACGACTCCAAACAAGCAGCCAT
CCGATGGCGAGAATGACTCGAGAGGAGAGTTCGGAACGGATCGGTGGATTCGAACCACATTGCAGCCTTACCGCCTTG