Description :
From Genome Similarity Track
Location :
Scaffold_9:104187- 105434
Transcript NameFunction/comments
Phyke_g863hypothetical protein PHYSODRAFT_295941

Sequence
1247 bases(100 bases per row)
GGGTCACTGGAAAAGCGGTTTGACCGTTCATCGAGTCGATCGGATGGGAACCACAATAAAATGAAGCCGTCACCGCTGGTTTTTGGTCCGCCGGTAGACC
AAAACGAACTTCCAGTGTCATTGCTGTCACCTGTCGACTCCAATTCAAGCGATCCTGCGACTTCGGAGGAGCCGGTGGGAGTAAAGAACTTTACGTCAGG
GGAGTCAGTGGATTTTTTCGATGCTTCGGATAGCGTAGAAGTGCAGCAGAATTTTCGTCCACACACAGCGGCCAGACGAAGGCATTCTAGTGCCGAATTG
CTGGGCGCAATCGAGAGCGGCGGGCTGATGGAAGCTGAATTGCTGTCTCTCAACAAGAGTAACAGGAGAGCGTCTCCTGAGGTTTCATCTGTTTCTGAAG
GGGCGCAATGGGGGATAGCTCATAACAACAATAACCTCCATACGCAACGAGAGATTTCGTTGGACAAGTACATGGTAAGATGTGACCATGGAAGCCGGTG
CAATTGCGCCTATTTAGAAGTTGAAATTACTGATGTTTTATGCTCTTCCTTCGTAGAAAAGCGCTCATGAACAAATCCGCAATGGTATTAAGCATTCGAT
ATCCACGCTGTCTGGAACTGAAACAGCATCGATGGACCTGAATCAATTAGCCGTGACTCTAGAAGACATCGCCTTCGTCGTGACGGGCCatctgctcttc
agcatgAACTTTCGCTCGCCCAATGGTTTTAACTACGCGAACCTTGTGAAAGTGAAGAGTATTGCAATGGCAGAAACCAACCGACCAAGTGCGAAAGAAA
CAGATTACAATTTCAAGTGGCTTGCTGGTACTGTGTGTCACAAGCACTTGAGCCATAAGCAGATGGCACGCGAGGTCATTAATCCGCGTATTTTACTATT
TGCCTGTGGAATTAGCTACGATCGCTCGAATGGTGCAGGCCGCATGAGCTCATTGGATACACTGTTGGAGCAAGAAAAAAGCTACATGGCCATCCTCGTG
GAAAAAATTTCGCGGTTGGAACCAGACGTGATTTTCGTTGAGAAGACTGTTTCACGATATGCACAAGAACTGCTACGTGAACGCCAGATATCGATCGTAC
TTAACGTGAAGAGTGAGATGCTTCGCCGAATTGCACGACACACTGGTGCGGAGGTTCTGACATCGGTAGATCATGTGGACAAATCAAATCCAGCTAACGT
TATCGGTCGATGCCGGTCGTTCACCGTGAAATCTATCCCTGTTGTCC