Description :
From Genome Similarity Track
Location :
Scaffold_12:1041802- 1045465
Transcript NameFunction/comments
Physo_464232Hypothetical protein
Physo_320993PREDICTED: putative nuclease HARBI1-like

Sequence
3663 bases(100 bases per row)
AGAACCGAACAAATGCAATAAAAAATGACTGTAATCTCTCGATTCCTAGTCGTCTTGGTGGTCTGTCTTCCTCGGGTTCTGGTGGCGGGACAAACGCTGA
GAACATCCTGCTACCCATTGTGTTGTGGCTTGGCAGGCCGTTTATGGCGCGTAGGCCCTTCACGTTAACCGTGAGCTGCAGCTCGGTCGAGCCGTTGATG
CGGCCAGAAATGGTTTCGAAAACCGCCTCGTCACGATCCGCGGGAAGGTTCGCAGCACCAACGGCGTCCCGGTGTTGCATCTGTCGAAACGTGGCCGTCT
CGGGAACGGAAACGGCGGTGCCTACTGGCTGGCGCGCATCTCCCAGTGCGTACGAGCGATGACACCAACTTGAAGATCCGGCCGCTCTGCAAGGAGCTCG
TCAATGTATTCCGCTGCCCGTTGATTACGGTTTCGTGGTGCGCGTCGCCTGCCTGATTTCCCTGACAGTAAATGCGAAGAGCTCCATGCAGAGCGGCCCT
GTGTCCTTGCGCCGGCGCTGGAAATTGGTTCGGACCGTGGCCACAACGGCAGTCCAATTTGGCTCAGATAAAGCCACCCAGCCCTGCTGAGTGGCACCTT
CACTTGGCTTAGCGTAGAGGTTAGTATCAAGGCGCAGTTAGCGCGGCTTCGATGCGCTCTTCAGCTCTCGCAAAGAGATCATCAAAGCTGCGCTCTGGAT
CGAAACGAAACTCCGCATCCTCAACACGAACGCTAGTTGTGCTCGTCCTGTTGATTCCTCCGATATTGACTGAGATCTTGGCCAGCGCTTGCATTGCTGC
TCTCTTGGTAAAGTTTTTGTGCGGCCTTCCTCGGAATGCCGAGGATGGAGCTCACATTTTAGCCTGTTTAGAGAACAAATCGATTCCGACTCTAAAATAG
CTTTGACGCGATGCTCCGACTATAAATACGAGTGCTCAACTATAAATAACGGATATGATGATATAAATAAGGGTCCCCGGCTCAAAATAAGGCACTAAAA
CAGCCGATTTACAATCCGAATATACATTCCAAGTGCTTTTCACAATACCTTCTCGTTCTTGAAACCGCAATTGCGAAAAGTATGCTCAATGTCATGCGCA
GGACATCCTTAGCATATCGGCACCGGGTAGCGTTCCGGACGATATTTCGCTCGTGACGATGCAAGTGCAATATCAGGTTCTTGCTGTTGGGTACGTAAAA
CGCATCGCGAACGATCGGGTCACCATGTTTGACTACAGCCTGCACGCTATTGTGGCCGAGCGATGTCGCTGCGAATTTTATTGTTAAATCCGTGCACGAA
ATCCGCCTTCACGACTGATAGATAGTATATGGCCATGTAAACGTTGGCGACATTGTCGCAGAAAAACAAACTCCCTGCAACATAGTGTCTAGAACGTTTA
CTTCTCAGTTCCACATGAAAATGCAGTAGATCGCCAGAAAATATTTAGTGTGGTCCACACTTACATTTTGATTAGCCAAAATAATCTCTGCTTAATCGGA
GCTCATCGATCTCTAAATTGCTGTGCACCATTCAAGCTTTCGACTCCGACCGCAGAAGCCTCCAGTCTACATGGGTCGCCCGCCCGGAGCAAGCGACCTC
CCACCCCAGACAAAAGTCGCCGTGGCGCTCTTTCAGGTCGACCTGGCCGCCCGTGGCACTGGTGCTTCAGCAGCGGTTGCGGTCGCTGTTGATAGGTACC
CTATCAAGCCTCGGACGGCATGGTCGTTGTGGAAGGACCGCACCAACGTGGCGGCGCTGCTGGATCCACCGCGCAGCCCCAAGCCCCCGAAGCCGACCAA
CCGGACGAAGGAAGAGGTTGCTGCTCTGCTGGCTGGTGTTCCGCTAGTTGAGCGGCAAACCCTACGGTCGCTGGCCACCGCTTGCGGGATTCTTCCTGCT
TCGTTATGCCGCTACCTAAAACAGGGGTGGCTTCGACGAGCTGTATCGCGCGTCAAGCCGACGCTGACGGAGACGCATAAGTTCAGACGTCTGCTAACGA
TAAAATTCACAGTTGGTCCCTGCTATTTTTTTCTGATTTTACGAGTAAATTTCCTAGATTCAAAAACTGTTCACTACTGTGTGTGATGTACACCATGGAC
ACGGTCAAGATTCTGGAAATAGAACCAGCCACAATATATACAAACTTCGAGATGTTACAATTGCCATAATCTGTGAAGTATGGACTCAGCCGAAATTTAC
CAATTGAAGTTGGGGGGGGGGGGCTTCCAGCCGCTGAAATAAAATTGGTTAGGCTGTTCAGTCAGCAAAAGCTGTCCTCCCAGTATTATGGTAGATGCAC
GGAATAGCGTTTATTTGATCGCTCACAGCAGCTTTCCGCGAGTTGTGCTACGGACACTAATTTCTAAGCCTATACTGTGGTCGTCGTAGCACGGTTGATG
TAGTGTATGGTTCTCGTCCACTGAACGTCGAGCCCATCGCGTGTAGGTCCCTTGCGTTTTTAAAATGTGGGAGAGGACTGGGGATCTTCTTCAAGTAGTA
TTTCTTCAATTGTTCTAGCTTGTGGCCGTTAAAGCAGTGCCCTTACTGCGTGTCGGGCTTCTTCGCTGCTGCGGTAGCGGTAGATCGCTCGGTTGCCATA
TGCTCGGCACTACAGGCGATTGGAGCATGCTCACTGCATCTGGCGTAGGTGTTGATCACCACGATCCTTGCGCTGACCGTTCTTGTTCAAGCGACAACAC
AGTTGTACTTGCCCATTCGAAGCTTTTGATCCGTCAGCTTGTCGGGAGTGTTGTGCTATCTCGCACCAATTCCAACCAACCCACGACGATAGTCAAATGC
CCGCATCATCATGTTGATGAAAATCTGGCCTCTCAGGCCAGCGTGGTAACAGTAACCTGGACGCCGAGCGGGAACATTGTGCTTACGTGTACCAGTTCGA
CTTACGCTTCACATTTTGGAGTTTGTTGAAGAGATTTTTTTCTTGATTAGTGCGGGTCGCTGCGGTTGTCTTGCCATCATACATATCTACCAGATACCTC
CCCATTTGAGCAATCATAGTCTTAGTCTTAATTCATTATTCTTCAAGGTCCATGGACAATGCCGATATGATACCGTGCTTCACCAGCTTCTGGGTGTCCC
TGAACGCCTTTTGTTTTGCTTACCCCAAACGCTAGCGCCGCGTACCCGTTCGCGTTCCCTAACACGTCCTTGTACGCACAGCCCCGGCCGAGTCAGTTCA
CTGTGCATTAAATCTTGTTTAACTCGGCTTTGATCAACATATTTGGTACTTGAGCCCTCGATACCAGTCTTAGGCCCATTCCTAACCGGACAATGTGCCT
GCCATTTGTGCCAGGCTCGTTTATAATTGGTTACTTTCACCGTAGGGGTAGACCATTTACTGCCATCGGTGGCACTCGCAAATCCCATGGCAAAAGCAAG
TGCCATGTACCAGGACGTGTATTTTACCACGCGTGTCGATATATTTCGCACGCGTCATTGACACTTTTCCCGCCAAGATGAACAGGACCGAAGAAGCTTT
GGCGCTTCTGTGTTGCATGTAGTGACCTACTACATCTGGTTCGATGAGCGTGGGTCGTGCTTGGGGAGAAGAAGGCTAGACTGGATGTATCACTCGCAGC
TACTCTTGAACGAAGGCCAATTTCGACAATACTACAGGATGTCTTTCCCGAGCTTTGATCGGC