Description :
From Genome Similarity Track
Location :
Scaffold_146:10418- 11810
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_146-snap-gene-0.7TRNA uridine 5-carboxymethylaminomethyl modification enzyme gidA

Sequence
1392 bases(100 bases per row)
GCAAAAGCTCTCGACCGTCGGCGAAATGTCGTGCAACGTCCGTGTGTCCGCTCGTCTTTGGCTTCGTCTCTATTGATCGTTTTCCTCTAACGCCTTTCTC
TTCCTCTATTAGCCGTCCATTGGCGGTGTGGGCAAAGGCACGCTGGTACGAGAGGTCGACGCACTGGACGGACTCATGGGCAAGGTCGCCGACCGCGCCG
GCATCCAGTTCCGCATGCTCAACTCGGCCAAGGGCCCGGCCGTGCGCGGGCCGCGCGCGCAGATGGACCGCGACATCTACCAGCAGACCATGCAGAGCAC
GCTGCGCGAGATCCCCAACCTCACGCTCGTCGAGGACGGCGTCGAGGACCTGCTCCTGCAGCAGAACCAGATCGCGGGCGTCGTCACGAGCTCGGGCCGC
GCCATCCAGAGCAGCAAGGTCGTGATCACGACCGGCACGTTCCTGCGCGGCATGGTGTATCTGGGCCGCGACATTCGCTTCCCGGCGGGCCGCCACATGC
GCGAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGCTCGCGCAGACGCTCGAGCGGTTCGAG
TTCCCACTGGGCCGGCTCAAGACGGGCACGCCGCCTCGTCTGGACGGCTCGACCATCAACTATGACGGGCTCGAGATTCAGCCGAGCGACGACCCGCCGC
TGCCGTTCTCCTTNNNNNNNNNNNNNCGCTTCACGACCGACAAGTCGCGTGCCACGCCACGTTCACGAACGAGCAGACGCACGCGATCGTACGCGACAAT
CTCCATCACCTCCCCGAGTACATCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTACTGCC
CGTCCATCGACGCCAAGGTCGTGCGCTTTGCCGACCGCAGTCGCCACCAGATCTGGCTCGAGCCCGAGGGGCTCAACACGTCCATCGTGTACCCGAACGG
CATCAGTACGGCGCTCCCCGAGGACCTCCAAGTGCAGCTCATCCGCACGATCAAAGGACTGGAGCACGCCGAGCTCGTGCGGCCCGGGTACGCGGTCGAG
TACGACTACATCGACCCGCGCTCGCTCCACGCGACGCTCGAGACCAAGAAGATTGAGGGCTTGTACTTGGCCGGCCAGATCAACGGCACGACGGGGTACG
AAGAGGCAGCCGCGCAGGGCATCATCGCCGGCATGAACGCCGGGCTGAGCGCCGTGGGGAAGGCGCCGTTCGTGCTGGACCGCGCCGACGCCTTCATCGG
CGTGCTGATTGATGACCTCGTGTCGCTGGGCACGACGGAGCCCTATCGCATGTTCACGTCGCGGTCCGAGTACCGGCTCCTGCTGCGCCAGG