Description :
From Genome Similarity Track
Location :
Scaffold_4:104159- 108622
Sequence
4463 bases(100 bases per row)
GGTGGGCATCGTGGGTGTGAGAAGACTTATATCACGGTAAGTCGCGACTTTACTGGCCCCTCCAGTATCAGTTCGTGGGCAAGTACATTCGGGCTTGCAA
AGTGTGCCAACGGGTGAAACCTAGTCCTACATCCCTTGCACCACTACAGCCTCTCCCAATCCAGGCAGAGTGCTGGCAGTCCGTTTCAATGGACTTCGTC
TTCGGTTTCCCCAAAAACGCTCACAAGAATAACGGTATTCTTGTGTTCGTAGACCGTTTCAGCAAGATGGTACATCTTGCTGCAGTTAATGATTCAATTT
CAGCACATGACAGTGCCCGTGGTTTTTTATTGACACGGTATTCTAACTGCACGGTCTACCCCATGAACTAGTCTCTGATAGAGATCCTCGGTTCACGGTG
GCGTTTTAGCAATCCGTGTTTCGATCCCTCCGAACACGTCTGACGATATCTACTTCTGACCGTCCCGAGACTTATGGTCAAACAGAACGCTTCAAAAGAG
ATACTTCGAGGATACGTTCAATCTTTCACAGATTGGAGCGAATTTTTGCCGATGGTGGAGTTATCAAACCAACAACTCCGTGCATGCATCTACAACAAAC
ACCATTCTTCGTGAATGGCTTACACCATCCACGCGGTGGGGACCCACCCATTTAGAGTGTGACACTAATTCAAGGGGGGGGATTCGCTCGAGCAAAAACC
GTTCTGTCTCTTGCTCATCACGCGTCGAGGTATTCGACGACGCGAACGTTGCCGATGTCTATCAAGTCGACATCGAAGAAGATAACCTTATCATAGTGAC
GACACTATTGCTGATCCAGATGAGGATGACGATGCTGGTATATTCAGCATCGTCAATGACTACACCAGCGAGGATGAGAACACCCTCGCTGAAGAAGAGG
ATAACCTCCTAGAGGTGCGCACAAGGCGCACTGCAACAGACCAAAGTGATGCAGCAGAAGATTTCCTGCTATCAAGAGAAGCAGTGGTCCGCTTCGTACA
AGACTCCATCGCTAAAGCGATGGACCAGCAGAAACGGAACGCTGACAAACACGGAAGAGCAAACGTTCTTCTATTTAATGTCGGAGACTTAGTTCTAATG
TCTACGGTAAATCTACCTAAGCACCCAGTAACTAATGCGGATAGTAGTAACCTACGACCCGAGAACATCGGCCCGTTCCGTGTACTACGTCGCAAAGGCA
ATGCGTACACAATCGAGTTGCATCGCAGGATGCGTACACATCCTACGTTTTATGTAGGTCGTATCCGCCCGTACCATCCCCACGAGGTCTCTTCCTCGGG
CAAATACAACCGCCACGCTCAAGAACCTCCAAGCGATTCTTTTGGTCCCGAGCCAGCTTCTAAATCTGGCTCTATAGAGCATCATTCTGGCGACGAAGGT
CAGCCACTTCGTCGCGAAAGTCTTGACGCGTCCGCTCGTTCTCCAATTGGTAGAACACAAACTCTGATCGGTCGTCCGATTGATAAAGGCGGAAGCGTTG
CACTCACGTCTCCAAATAGATACGCTCCTGCCTCTCTCGTTCGGAGCGATCACACAGATCGTGTAAGCGTTGCGGGAGACGACCAACCTCCGCCTGCAAC
TCCAAGAGATTCGGAGTTAATATTCCCGTCTCCACCACAGCCATTGGTGAATTATCACGGTGGTCAACGCTTTCACGTAGAGTGTATCTTGAACCACCGT
GACATGAAGGGGCAGCAAACAAGTTACCTTGTTCGCTGGTACGGCTATCCGCCGTCTCACGACAGCTGAGAGCCTCGAGCCTAGCTGATGATTGACGTTG
AGGGTCTCGTCCACCTGTACAACGAGACACATCCGATGGCTCAGAAGGTCCATCGGAAAACACGCGCCCATGGCGCTGGTAGAGCAATTGCAAGTTAGCA
ATCGCATCGCGCATCTCAGCAGAGATGTGCGCCCTACCCGGGCGAAAAAAGGGAGTACAACCCCATTTGGATGTGCTGAGTGTTGTCGAAACAACACGGA
CATGGATCGTCCCACGTGAGGCATGGAATTCCTGCCTCACGAGACAGCTTGTGCAATCTGAATTTTGCACCAGTTAAGGTTCGCTTCTCAAACCTAACAC
GAGCTGTGTTAAGTTTTTGAAGCCAAGCCTCGCGCCCAATGTGCTGCATATTGAGTACAAAGGCGTTCCTCGCCTGCAACAACGAGCTTTTGTCTTGCTT
AGTGTTTCCACTTTCCAACGATGCTCCAGGAAATCATCCAGATAGAAGTCTTCTTCAGCGCGAAATATACTAGCGCTGATGTCGAGTCCGTGTCACTGCC
TCGCATCGAATAGTGGGTTTCGATGATGAAGACTTATCTCGCCTGACAAGTCATTCACAAGCCTTTACGGTATCACCCAATGCTTATGTTCAGGGGATCG
GCGCAGCACATTGCCGTCTAGAGCCTCCTGCGTGGTACCAACGGAAGCCTTGGTACCACTTGGATCGTCATCACGACGGTTCAACTCATCACCGCATTCG
CTATAAGGCGAATGCGCAGTAGCAAGCGCAGGGGATGTGTCAGCATGCTCATCCTCAGAACTAAACAGACTCTGGTAGTGACCATGAGTCTGACTACCCG
CTCGAGTCCTATTAGTAGGCTCGTACTCGCCCGCCACTATAGACTCGGGCGACCTAGATGTCTTCTTTGAGTCGGACTCACCGTCCGACTCCCCCTAGTA
GATAAGCTCCACTTGGGAGCCATCATCATTAGCACGTGGTGACTCACCACGTGCATATGCAGCAACTGGTGCCGCAGGAAGTGTCGGAAATGCGGCAGAC
GAAACATCGTCGGAAATGCGGCAGACGAAACATCGTCGGAAATGCGGCAGACGAAACATCGTCTGTCACACGGGGCTGTGAACTGTAACGAACAGCTACG
TTAACACGCGCAGCTGCTTTCACGGCGGCCTTCGCCGCGATTTGCATGGGGTTATTCGCCATGCTTGGTTATCTCAGAAAGGAGTGGACCTGTCCGACAA
GTGCTCCCTTTCCCTGACGTGGTCTAACCGTGAACACATCAAACATGATAGTTATTGAATAAGTATCGTTTAAGAGGGGGTGATGTAACGGTTGTGCCTG
TTACATTTAATCAATCCTCGATACTTTTTAATACGAATATTATCATGAAGGTTGATAATGTTCATGAATATCACCATAAGGGGTAATATTCAGAGGCAAT
CACTTATTGGCTGATATGGGCCATCATATCAGTCAACTCTAGCGGTCCAATCAGTGATGGACGCGCGAAATGAGTGGTGAGCAAGAGTTCAACATACATT
TTTGTAGATAAATATAATTAAGTTAGGACTAAGGCATAGGATAATGACTAGGACTTAATTATATTTCGTACAGTTTTACTTTCTACTTTGATTGACCGCG
TCGTTCAATAGCTAGCCTTCCTCTGCTCGTACGGTGTACGTAAAGTGACGTGCGGCACTACTTACACTGCGTCAGTGTAAGTTGAATTGTGCTGCGTCAG
TACAAGTCACCAGTGTCCCGTTACATGCACCCAGATGAACGGCTTGTGTTAGTTGTGTGATTCGACCTCGGTACAGTACGGTAAGTCAAAAACCCTAGCC
GTGAATAATAGAGACAGTAGGATGGTAGAGTTCAAAATGAAAACCTGTTTTACCCTAGTAGCCACTGCTGTTGCCGTCAAGAATCGCCGAGGAACATTTT
TGTGCAGGGTTCAGCTCTTGTTCATGAGGTCTCCTGTACCTATAGCATACTCAAGCAAATGATTGGTTCCGTATGAGGAAAGACCCCGATGCCGTGACAA
GTGACGCTGTGGTATTTTGAAAAACATCTTACTTTTGGCCGGTTGGACGCGAGGGCCGATAAACCTTTTTCGAACCGTCGAATGACCAATAGATCCTGCT
AATTTTGACAAGCGTTTCGCAAAAGAGGGTTAAATCGTTTAAACGAAAAGCAAGAAATATGAGTCGCTGGTGTTCCCTGCCGTGGATTGACTAAGTTTCT
CTAGTTGCTCATCCTGTATCCGGTGTTTTCGACCACAATCTGTATAGGTAATTAAGCTAAAGCCAAAGTTGAAATGCGCGGATACGTCTCGTCATACTTG
TAACGGGGCCCCGATAGATTGTACGGTCACAGTACAAGCTACTTACTCTGAACACAGGGTAAGGACGTCCCATTTGGAATCTCACGTACACGTATCGTGC
AGAGAAAGGTTTCAATACGAGATAAGGGTGAAAGTAGAACTGTATCTATTATAGGTAATCTCCTGCTAATATATTATATTTAGTCTTCTTTTAACTAGGC
CTAAATACAAACATATATTGTAATTATCTGCTCACCACTTATTGCGTTGTTTTGAGTTCCCATAAGCATGTCGATAATCCGATTCGATCTCCTGTAGGAC
GACTTATGTCTCGATACATCATGTCATGCTGAAAGACACGGGATCGACATCCACCTTGGTCGT