Description :
From Genome Similarity Track
Location :
Scaffold_269:10415- 13008
Transcript NameFunction/comments
Albla_Nc14111400conserved hypothetical protein
Albla_Nc14111410

Sequence
2593 bases(100 bases per row)
AAATCTGACAGACGTCAAAACCCAGCCACAAAACTGATAGCGCGACAAAATGATCGAGCTCATATACATGTCACTTGTGGTGTTCAGAGAAAACCCCTTC
TGCTCTATTGGAGGACATTGCGATTAGTATACGGCATAACTAGTATAGTATATCTTATATGCTCGGAACAGCGTGAAGGAGGTATTGTACTAGGAGCAAA
AGTTGTTTGGCGATAGGAGACTGATGAATACTTATCTATCGTACCATACCGCATTACGAACACCCAATGAGAAGACCGAAAAAATATCACCGAATGTATA
TTAGATTATGTTATAAAGTAGAGTATAACGAATAAAATGCCAAGCAATGTCTTCAAGTATCACGTGCAATTACATAATGAAGTCGAGAAAGTCCATTAAT
AGCACGTGTGAACTCCAACAAGCAGGAAAACATTATTGCCTACAAATCATGCCAGTCCATTTTCACCAGCCGTATTTTGCTTGTGTCTCTGCTCTTGTTT
TGATTGCGAGCCCTTTTTTATTCAATAAGTCTTGCTCTCGAGCCCGAGCATCGAATGCCAATTGATTCAACTGATGCTTCTGTCGCTGTAATCGCGTAGG
TTTGATGGAGGAAACCCGACCTCCTACGCGCGCATTCCAAAAGCTCGCAGCCACATTGACTTCTTCTTTTTTAATGGCCTCTATCATCTCGATCGTTGGC
TTCCAGGAATCTCCGTCTGGACCTTGAACCTCTTTGATCGGTAAATCCGGACTTAAAGCATCGAATTGACCTTTTTCAAGTGCTCGTTCAAGTGCTCTTT
CATTCAAACGCGCTCGTGTTCGATTGCTTGCGGCATCTTTAATCATTCTCTCACCGCTATAGTGCTGCATATAAGGCTGTTGGACAGTAATGTTCGATGT
CTCATACTCTTTGAGTGTTTGTATGTGATCTTCATCATGAACAGAATGACTTTGTTCGGGTAACAATGCACTTTCATACGAACGCACCGGTTTTGGCAAG
AAATCTAACGCCGAAGCCTCGAAATTCTCCTCGCTCATTCGTGTGGATACATTACAATCATATTCATCATCATCCTCGTCTGAACTCGCATCTATTCCAG
TCTCCAAGAGTCGTTGGATAGCCTCAGGCAGATACAAAGCACGTTTCTGTGGTGTAGCGGGAGTCAGGCTTGTCTTAAGCCTCTTTGTCGCGCCGCAATC
TCCCTCGTCATCGGAAGAGGAGCATGTGTATTCTGGCGGCAGTAGGGACATCGCAAACGTGATTGGTGCAAAATGACAAAATTGTTGATGAATTAACTAA
TCAACAAGAAACAAATTTGATTTATCTCCTCTTCTTCCTTTGGTAGGAAACAGACAATTCGATCCTCATTCTTTCTTGCTCATGTGCTCAATCAAATCCA
AAACACGACAACTGTAGCCCCACTCATTGTCGTACCACGAGACAAGCTTAACGAAATCATCAGACAGCGCAATTCCAGCTTTTGCGTCAAAAATGGAAGA
ACGACTGTCACCGATGAAATCGCTCGAAACGACATTCTCATCTGTGTACCCCAAAATGCCCTTAAGCTCCGATTCGCTTGCTGCCTTGATCACCTTTTTG
ATATCATCATAGGACGCTTTCTTTTGTAAGCGAGCTGTCAGATCGACAACAGACACGTTAGCGGTTGGAACACGGAACGACATTCCTGTGAGCTTTCCAT
TGAGCGACGGAATCACTTTTCCGACCGCTTTAGCAGCTCCAGTCGAACTTGGAATAATATTGAAACATCCACCACGACCACCACGCCAATCTTTGTTGGA
TGGTCCATCAACTGTTTTCTGAGTCGCAGTCACAGCATGAACAGTGGTCATTAGACCTTCAGCAATGCCAAAGTTGTCGTGCACAACTTTTGCTACAGGA
GCCAAACAATTGGTTGTGCAAGAAGCGTTAGACACAACATCCATATTCGATGTGTACAATTCGTCATTTACTCCCATGACAAACATCGGAGCGTCAGCGG
AAGGAGCTGAGATGACCACTTTTTCCGCACCATTTTTCAAGTGCGCAGAAGCTTTGTCGATAGTTGTGAATGCGCCAGTCGACTCGACAACATATTGCAC
ATTGGCTGTGTTCCATTTGATATCCTGTGGATTCATTTTATCAAAGACTTTGATGTTGTTTCCGTTCACAATAAGATTGTCTCCTTCGTGAGTAATTGTG
CCGTCAAAGTTACCATGAACTGTGTCATATCGCAGCATGTACTCCATATACTCTGCAGAAATGAAAGGATCGTTGATAGCGACAACTTTGATCATCGGAT
TGGATTGTGCTGCACGCAATACAAGTCGACCGATTCGACCGAATCCGTTGATTGCAACATTCACGGGACCACCAACTTTAGATGAAGGATTCTGACAATT
GATAATGTTCAAGAATTCAGACTTTAATGAAGCTCCTCCGACGAGGAAACCGTCAATATCTTTCTTCTTTGACAATTCGTTTGCATTGGATGCAGTGACG
GATCCCCCGTAGATGACACGAGTGCGGGAAGCAACATCCGATCCAAATTTTTTTTTCAACCAAGAACGAATTTCTTCGTGGACTTGCTGGGCT