Description :
From Genome Similarity Track
Location :
Scaffold_139:104141- 114149
Transcript NameFunction/comments
Phyin_T30-4PITG_20376Voltage-gated Ion Channel (VIC) Superfamily
Phyin_T30-4PITG_20377Pseudouridine synthase
Phyin_T30-4PITG_20378Putative uncharacterized protein
Phyin_T30-4PITG_20379Putative uncharacterized protein
Phyin_T30-4PITG_20380Putative uncharacterized protein
Phyin_T30-4PITG_20381Putative uncharacterized protein
Phyin_T30-4PITG_20382Putative uncharacterized protein

Sequence
10008 bases(100 bases per row)
TTTCAATAAATAGTTTTGCCAAGAGATACCGTAATATTTATTCATCAAGCTCCATCATACCTTCCAGACGCACGAGGATCTTTGTAAGATTGTTCATTTT
CGCCTCAAGTCGCTGTTCTGTCTCAATAAGTCGCTCCTGGAAACTCTCCTGCATGTCAAGCAGCCGAAGTAGTAGCTCATTGTCCGGCATAATTAGATGA
GAAGTACTACTGGACGCAGATAGATTAGGCTGGCCATTCAGTCCAACTGCGTCAGCACTTGGCCCATTTTGTGGGGACGATGCAATAACTCTGATCGGGA
TATTAGATCTTGTTTCTGGAGCCACGGAGCTGACGACTGAGGTGGGCGGCCCCGAAATACTCTGACGACGATGATCCATGCTGTTGGTTCGAAGAACCTT
ACTTTGCAGTAACAATTCTGTTGATGATGCTGACCCCCGACGTTTTGTACTGATGGAGGGCGAGCGATGCAGACCCACAGTAGGAACAGCTAATTGATTC
ATGAAGGCTCGGTTTTGTAAAACCTCTAGATCATTACGAAACTTTGCCAGTTCATCATCTTCAAGCATGCCACTGTTATCGGTGTCGTAAACGTTAATAA
CATCGTCAATGTCGAGATGAATTCCTTCCGTCACCGCGTGGAACCTCTCTAAGATTGCTTCGATCTCGTTCCGGCAGATCATACGTTTTCCTTTGAGATA
ATCCACGTTGCTCTTCATCGTTTCGTGCATAACGGACTTCATGACTTTTTGAAAGTTCGTACCGATGACCGTGATCGGCAGTGCCAGAACCAGCATACCT
GTGAGCACAGTGCAACATCCGATGACCTTGCCAAACAAAGTAACTGGAGTCATGTCTCCATAACCCACGGTGGACATTGTCACGATGCACCACCAGAAGG
ATGTTGCAATGCCTTGGTATGGATTCGGATCCACGCACACGCAAGCATCACTTGCCGAAACTGATGCTACGGCTGCGGCTGCAGATGTAGAAAATGCAAC
TTCAGCGGTGTCAACATGCCCCGAGGAATCGGCTTTACAATTTCCCATCCATCCATCTGCACGACAACCATCGTCGGTATATTCCGCAAAATAGATGGCA
GAAGAGAAAATTATCATGGCGATCGACATGAGGAAGATCAGCATTGTCAAAGGTTTAATACTGATGGAGATCGCTTGTGTGAAGACCTGAATCGCTGATG
AGTACCGTGACATCTTCAAGACGCGCGCTACTCGTGTGAGCCGTACTATCCGAATAGCACCGAAAGACCCAGCGTTGTCTACAGCCAAAAGTGACTCCAT
GTAAAAAGGAAACACTGCTGCAAAGTCTACCCAATTCGCGTAGTCTAGAAACACACACACGGTCAGAAGCAAGACACATTGACTACAGAGAGCATAACGC
AGTACCTTGAAGGAAGGCCAATTTGCTAGGGCACACGACAAAGCGTCCAAGCAGTTCGAAAGAGAAAACGCCTGCACATATTGCCTCCAGTGTAGTGAGT
ACAACCATGTACGGGTCGAAAACTTCCTCCGTTTCAGCGACAAAGACAAACGTAGAAATGATGATGAATCCATATATGCCCAGAGAAAAATAATATGCCG
GTGTGGACGATTGAGGGTCTTCAAAAAATTCCCACAATTTGTTCATGCAGCCCCCGGGTTCATCAGCGTTTTCTGCTTGTAGCTCGGAGGCAACTTTCGA
GCTATGTCGTGCCGATGCGTCTTTGATCAGATCAGGAATTGGTATACGAGAGCTGCTACGTTCGGTTGACGTCACAATGGTGTCTTCCTCCGGTGTGGGT
GCCACAGACAACGATGATCGCCGACTCCGTTGACTCCTCTGTACCTTGTCTGCCTTTGTGCTGAAGAACGACGGGAAGTGGGGATGGACATTAAACAGCC
TCGAGGTGTGGAGTGCTGACCGTCGTTTGGCTTCCCGTTCGATCACCTTTGACAGCTTGAGTGCTGTATCCGAGAGTTCCATAGGCACAAAACCGGTGGT
CGATTTGTTTTGTTGCTAGCAAATGTAGGTTGATAGCCACGCAACAACAGTGAAACGCGATAAATACTGGCAGAGCTAATGGGGCGGTCACCAGGCCCAA
TACACGCTACAGGCCCAATTGATTTCCTTTTTCACATTGCAGGCAGTTAGATCCCTAAAAATATGCGCATGGTTTTTGGTCAGAAGCCAAACACCCGTAA
ATAGCTGGGAGCTGTTACGTGTTGCCAAGTCTGATACCTGTCAAGGTGCTTGTGATCACTCGACGAAAAACACCACGCCTACAGTCACGACTTTTTAGCT
GGTAGCGGGTGTTTCCTCTGGCTTCGCTACCTGTTCTGCAGCAGCTGTCTCCGTATTGTTACTAGCCTGAGCAGCGACTCCACCACGCACCGCCTTCGCT
AACTCACGTCTGCCTGCACGATCCGTGCGTAAGGCCTCCTCTTCTTTCTCCTTTTTCCATTCCAGGTAGGGCTTCGCAACATAGTCGAACGGAAGCACTT
CCATCGTACGCAGCCATTTTGCGTATGTGCGGGTACGCTCTTCGTGCTTCATGATGTGATCGTAGATGACATCGCGTTTGAATTGCTCAACAGCAGCAGC
CACGGACGGCTCCTTCAGGTCAAGAGGTGGGTGCGATGTCTGGATCGTATCCTCCATTTTCATGTTGTACACTTCAAAGTGGGCTTGTGCCAGGTACAAC
CCCACACTGGGCGCCTTGGGCAAGTCCATCTTCGTCAGCTCCATGGCACGCTCAATCGTCGAGGGGTCAGAGACACCCGATACAACCTCCACAGCTGTTC
CGATCATCTTGCGGATGTGGTGCAGCAAGAAACTCTGTCCAACAACACGCAGTCGCACCCACTCCATGTCGTTCTGCACAAATGGGCGCTCGGCCTCGAA
AGAAATAATAAAGCGGTTTGCCTGAGGATTGGTGGGCTCCATCTTTGACGTAAAGTTGTGGAAGTTGTGTGTGCCCACGTACTGCTTCAGTGTGGCGTTG
AGCTGCTCCAATATCTCGTCGCTCAGCCGGAAGGCCTTGTGTGCCTCCAGTGTCGTGTTGTCAATTACCACATTGCTGTCAAAACCCTCTTCAGAGTCCC
GGAGGTTGGATGGCCACTGGTTCGTACCTTCAGCCTGTTTTTCCTCGTTCTTCGAGGCAGATGAACGCATTCGTTTGCCGAAGATAAAAGTGGGTGCCAG
ATACTCGTAGGTACGCTGGTCGCATGTCATCTTAGCGTTGAAGTTTTTCGTGACTGTGACCATGTGCATAACGCGGATGTCCTCCGGTAGCGCAGCGTCC
ACCTTGGCCATAAAGCCGGCAATGTCGTCGCCCACGTGCAACTTGGCCGTCAGTAACTGACCAGCAGCATGCACACCCTTGTCGGTGCGGGCTGCGCGGC
TCCAGCCGATCTTCTGCAAGTAGCCGTAGTTGCTCTCGGCGATTCCACCAGCTTCGAACAGCGCACGTTCCAGCTCTGCTTCGATCGTTTTCACGCCTTC
ATTCATCTGCATACCACAGTAGTTCTTCCCGCAGAAGGCCACCCATAGGCCGTAGCGGCGTTTGGTCGGCATTGATGGTGCATTTGCTGCAGGAGTCTCA
GACGGCTGACGCTGCGCCGCGTAAGATCCAGGGTGAACGGCGTCTGAGCGATCGGCACGGCGGTCCGACTGCGAATCCTTGTCCTGCTGCTGCTCATCGC
TGCCCTCGCGACGTGCCTGCTTGTTCTTGCGGCGCACGGCCCAGTGAGTCTTCTTGCGCTTGCCTGCCATGCCTGTTACGGTACGGCGGTGGGTGTTGGT
TGGCGCAACCGGTAGTGTCACTACCGGTAGGGCTTTGTCAAAAGCCATATATATGGTTGATGTTTGCCACACTATTCAAGGTCAAAGTTGGTCGGCTCAT
TCATGATCCACCGCTCAAAGTAGGCGAGATGGTGTCGCCGCGAAGTCTCCAGGCGCTGCGTCGCTCGGTGCATCTGGCCACCAAGTCGCCAGGAAGCCGC
CTGTCACCCTTTCAATTGCTGGCACCACAGACTCGCGTTTTCTCACAGGCGCACACACCCTCGCAGGCCGTAGACCCCAAGGACATCCTGAAACCGGAGC
TTCCCAAGGATGCCAAGCCGCAGCTGTCACTGGAGCAGGAGCTGCCGGGTCTGCCTCAACTCAAGCCTGCGAGCCAACTAAAGCCCCCGCAGACGGAAAT
TTCGGTGCTTCCCTCAGATCTGCGTGTTATTTCGCAGGAGACGTACGGCCAGGCAGCCACGCTCGGCATCTTCATCGACGCCGGTAGCCGCTTCGAAGAC
GACGACAGCATCGGTGTGAGCCACCTACTGGAGCATCTTGGCTTCAAGAGCACCACGTCGCGCTCACATGCGCAGCTGGTTCACGAAATCGAGGACATCG
GCGCACTAACAACGTCCTCGTGCGGACGCGAGCAGATCATCTACACAATCGACTTGCTCCGCGACAACGTGGAGAAAGGTTTGGAGCTGCTAGCCGACGC
CATTCTCAATGTAGACCTGGTACCCGAGGAGATGGAGGGCATTAAGGCCATCATGCGCATTCAGACGGAGGATCTGATGGAGAATCCGCCCGCCATGCTG
CAGGAGTTTATCCACGCTGCTGCATACGGCACCGACTCTCCACTCGGACGACCACTGCAGTGTCCGCTGGATAAGATCGATGCGCTGACTGTGGAAAAGG
TCAAGAAGTTCCGTGATGAGCACTTTGTCGCCCAGAAGATGGTCCTTGCTGGCTCCGGTGTGGACCACGCTCGCCTAATCGAGTGCGCAGAGAAGCTTTT
TGCGAACGTGCCTGTGGCTCCGGCAGATACGCGAATGGCGACCCCCTCGAGGCCTGAGACGCTTGAGCCGGTGATCTACACGGGAGGACTGTACCCCCTC
CCGAACCCGGAATCAGAGTTTTCTTACGCGGCGCTGGCGTTTCCTACGGGTGGCTGGCACGATGAAGACCTAGTTCCTATCTGTGTCCTTCACACACTTC
TTGGTGGTGGTGACAGTTTTTCTGCCGGTGGTCCTGGCAAGGGTATGTACTCGCGGCTGTACACGAGCGTTCTGAACCGTTTCTACTGGGTTGAGTCTGC
TTTCGCGTTTTCGTCCATCCACGCGGATGTGGGTCTGCTTGGCATCTACGGTGCGTGCATTCCGTCGCACACTAGCAACCTCGTGGCGCTGTTGTGCAAC
CAGATGCTCAGCGTCGCCAACCGACCTGTCGATGCGATTGAACTTGCTCGTGCGAAGAACCAGCTCAAGTCGTCCGTGCTTATGAACCTCGAGTCTCGTA
TGATCCTGTATGAAGACATTGGTCGTCAGCTACTAACCTATGGTGAGCGTGAGACGCCCGAATCGGTGTGTGCCAAGATCGACCAGGTTACGGCTGCGGA
TATCCAGCGAGTCGTGAAGGAGGCGATGCAGAACCCTCCTAGCCTTGTCTATTCAGGCGACATCCCTCAATTCCCGCAGTACCAACAGGTTGTTGCTGGT
ATCAAGGAAGGACTAAGCGAGTAAGTGTATTCCATTGAAGCAAGACTATCAGGTTGGGTTGCGAGTCTTCATTCGATGAGAGCAAATCAAGAGAGAGTCC
TAGACAAGGGAGGATAAAAAACAATAGAAAAGCGTAACACGAAATCCAGCGTGAACCCTTGGTAGCTGTGGAATACCCATTGGTATCTAACGGTGCTTAG
TTGCAGCCTCCTCAAGCAGTAAACGAAAACCTCGAAGATACTGCTGACACTGCGCGGCGGTGTCTGTCTGTAGATCCAGAGTGCGGCAAGGATGCACGAA
CACGAGTGAGAAGCAGCGGGCAGGTGCATCAGGTCGCTGGCGAGCAAAGTTCTCAGTTGTGGCACCCGGTAACACCTCGACCAGGTCGCAAGTGTCAGCT
TTAGAGTCAGGTTTTGGTTGACTGAGCGAGCTCTGCGTGACCGACGTTGCAGGTGAGCGCCACGACAACCACTTGCACTGAGCATCTGCATAAACGACTC
TCTGGTGGGGCACACCGCGTGTCCCGAACTTGGTTACAACAATGCCGTTTTCTAGTTGTTTCTTGAACTGCACCAGGATCTCCTGTTCTCTCGCTTGAGC
TGCCCCACGAGCCCGATTAGCGCTTTCCAATTCTTCCACTGCTGCCTGAAGCCGAATGTTTTCGATACGCTCATCACCGCAGCGCTGCTCAAGCTCGCTT
ATCTGACGTTTCAAATCGCTTTGCGAAGTGAGTGCTTCCTGCTCCACCTTTTTGCGAATAAGTTCCAGCTCGGCACTAAATGTACCACGCATGTTGCGCT
CACGGTTCTGCGCTTCTCTCAACTCTTCGTGCATCGACGCCAGAAGCTGCTTACTCGTGGTGTTTACCAGTTCTAGCGCACAAACTTGTTCTTGCAACTG
CTGTAGCTGCTGGTCATGGAATGACAATTCTACCAGCAGTTCATCGCGGTGCTGATTCAGGTCGGTGCTGGTGTCCTTAAGCCTCTCTTGTAGTTGTCGA
GATGATGCCGACGATGGGTTTGAGCTCGCTGTTGGTAGAGTTGGTGGAGCGACCGCAGTCACTTCAGTAACGTGTCGAGTTCCCAGTGCTGATGGGGGCA
TTGAAGCGCGCGAGTTGGCAGCCTCGAGCGCCGCTTGTAGTTCTCGCACCTGCTGGGTCTTGGCTGTATGGGAAGCCCGAAGTGCAGCTAGGACAACATC
AACGGCACGATGCGCTCGCTGGGCGTCTACCAGGCGGTCGTGCAACTCGTCTACGTGACTCTGAGTGTCTCGGTATTCTTCTTGCAGCTCCTGCCACTGT
AACGCAAGTATTTCTTTCTCATGGCGAAGATGATTCACTTGCTCTCGTCTTTCTTCCGACACAGTCGTCTGCTCTGCAAGTTGTGCCTGGAGATCTATCA
ACGTGTGCTCTAGTTCCTCTTGGTGGCGTTGCAGTTGTCTCTGCTCGTTTTTCACAGCTTCCAACTCGGCTTGTGTGGCCGTTGACGCCCGCTTGTGTCT
CAGTAGGAGCTTGTTCACTGCTACCATATCATCACGTTCGCGCTGCACTTTTTGGGTTTCCTGTAGCAACGCTTCGAGCTGACGAGCTGCTACTTCCTGT
TCCCTTTTCACCGCTTCTTCACGTTCCAAATGCAAAGCACTTAGTTGCTCTCTCACGCTACTTAGCTGGTGACTCACTTCAAGATACTCCGTTTTCAAGC
TATGCACCAATGCGTCGGAGTTGTCCGCATCAGAACCTGTACTCTCAGGAAGCTGGAGACAGTCGCTTTTGGTTTCGAGGCCAGCTTGACTATCACGACG
AGATTTAGGTTTCCCCGGCCCCATCGATAGACTGCTTCTGCGTCGAGTCGGTCGCGTTGAAGCAATACTTCCAAGACTCCTTGACCGCTCCACAAGACTG
ACATCCACTTGTCCTGAGCTAATATCGGCCAGCGTTAGAGTCAACGCCGGCTTTGCGTCGCGCATCCTAGTAGCGAGCAGCAAAACGAATAAGTTCAATA
TGACAGAGCCTCGAAATGAAAGATAACAATATCCTTACATTTGAAGAACATCGGCATACGGTATGTTTGCAACATCAACCCCATTTACCATACGCACCCG
CAGCTTGTCGACAATGATGTGAGAATAATCCCCCGCTGATCTGCAGCGCGCATTGTAGTCTGCTGCAAGACCCACGGGCGCAACGTCCCGAATGACGCAA
GCGTAGCTTTCGGCAGGAACGAGGCTACACTTGTTGCTCTTTGATGCGGGCTGGAATCCAAGACCTACTGGTTTACTGTCGTCAAAGAAAACGTTGAATT
CCTTCTCCCACCGACAAACGACTTCACTTTGTTTTGCTCGAAAAGCAGCAACCAGCAGATCATTCCACGCTCGTTCCACTCCAGACCGCCGGCCGTCAGT
AGCAGTAGCAGTAGCCTGGCCCTCGTCCGAATCGTGGTTGCCTGAAGGAGCGGTAGTAAGTTCATCACTCCAGGGTGGGCTGCAGAATTTCAGCACCATA
ACTAACTCCTATGGTTTGTTTCGCTGTTTGCGCTCTGGTAGCTCTGGTACCTGTAGCAGTGTACGCGCGGTTTGCTCTCCAGCTAAAATAGCATAACGTT
AAGAAAGTATTGTGGAGCTGTTGCCAAAAGTAACAGTGTGTTATTAAGAAAAATTAACACCGGCAAGAACATGTTTCGGCTTTCGATTTTGTTTGCATAT
ACTGCTTCAGTAACATGATCTTCCAATTGATGTCGCAGTAACTACTACTGGGAAGAGCAGCCAGGAACACGACATAGTGCACCCTCCGAACATGTAGGTG
CATGAGCCCGCACAATCACACCCCAGAGCTTACACGCGCCGCACCTGCTCACGTCGTGACTTGTCTTACCCGTCATATTCGAGCGGTGAGCTCTCACCTT
ACTCACGAATGTGCGTGTGGAAACACACAGTGGATTGGAGCACCCGCTGGCACTGCACGAGGATAAATGCTGTAGCCCACGAAGGATCGACTGCATTTGA
GCAGCACCAGGAGTCGTTGTTATTGTCGACTTGGCAGGAGGCATCTTCTTGGCATCAGAGACTTCTCCCACTGAGGTGGGGCTCAGTGATTCACGCCTAA
GGCGCTTTGCTGGTGGCTGAGCTGGTAGTTGGTATCGGAGAGACGGCAATGCTGCTGCTTTATTGGTTAAACCCTGTGCTGTCAAGACGGCGATGGAAGA
ACCGACTGAGGAAGAAAAAGAGGGGAGCGGTGAGAGCGACACGTGATGCGCTGCAAATGCAACGCGAGGCGGCGGCCCACCGTACTCCGACGGGAGCGAC
TCGCCGCTGAGGCTGCGCTTCCGTGAGATTCCATTAGCGACGATCTGCGAGCGCAAGATGGAGTAGGATGGCGGGCGTGGCAACGATGGCAACGAGTGGG
CAGCCGCTGAGCCAAAGGTGTCCCGATCAGTGCCGCCAGTCGTAGGAAGGCTCTGCGTAGTCAAAGAAACCGAGTGAGACGCCTTTTCATGCAGAGTATG
TGCGGAGAGGTTCGCACGAACCATTTCAGCTCCATCGGCCACCAGTGGAATGCCCGCCAGTTTCACGACGCGTCAAGACACGGAGAAGAAATTATCAACA
CAGGAAGAAGACAGCGCGTTGCCAATTGGAGTGCCCGAAGCTCTGTTCTGAGACTTGTGCAACATAGCACCATCACTCACTTGGGGTTAGGGGCAATTAC
TTAGCCTCACAGGTGGATGACAAATTTCCACAGGATAATGTTCCTCGCACACTCCTTGTGGCTCTGAAAGAAATGGAAAATATGGCTTTTAGATTTAGAT
TTTGCAATCGATTTATCTTGAATGTGGAGCGTTTTGATTTTTTCTAGCAGCTTAAGTTAAAAAACCTGCTTTTTAGTTAAAAAACCTTACAGCAGATTGA
AAACCAAGATTCTAATGATGGTTGTTTATGGCAAAGCTTTCTTAAAATTGGGAAACCAGCCTATTTATGACATACGGTCACAGTGGTAATCAAACCCGAT
AGGATGCCAATTCGCAACTAAGCGCGAGGTCGGACTGTTGGCTCATGACGGCGCCTTCTTTCTATGACGTGCTGGGCGTGCAGGCGAGCTCAAGCGCCGA
AGACGTCCGCCGGGCATACCATCAAGCGGCTCGCAAATATCACCCGGACAAGCGCTCGAATGATGTAAATGCGTACAATACCCACGACGAAGATGAGCAA
CAGTTCTTGCGCGTCCAGGAGGCCTACGAGACGCTTGGGAACGAGGATCTAAGGCGGGACTACGACACCAAGATGCAACAGGACGAGTTAGTGCGCAAGA
GAGAGCAGGAGATAGTGGTCGTGTCCGACGAAATCCCGCTTGTTGATATGCAGCGAGAAATCTTGAAGGGCGAAGATGGCGACGAGGACGAGGTGATCTA
CACTCACCACTGCCGCTGCGGAGATCTATACGAGATCACACAGGACGAACTGCAGGACGGTGTGGACGTCGTGCCATGCACCGGATGCTCGCTTCATATT
CGCGTACT