Description :
From Genome Similarity Track
Location :
Scaffold_130:104129- 105436
Transcript NameFunction/comments
Physo_143141reverse transcriptase

Sequence
1307 bases(100 bases per row)
GGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACGAGGGCTCATCGCCCACGTTCAAGGGCTGCAGG
CCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAACACCTTCACTTCTGGGTTCG
AGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCTAAGAGTTGGGCG
TATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACTACGAGTACCGCC
AGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGTTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGTGGGGAACCCCCT
GCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAACACTATGGAGGAGGCG
ATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTCTGGCGGTACGCCTAATGGTA
ACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCTGTGGCAAGCTTGGGCACAT
GAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGTGGTCGCTGGCAGAAACCGCGCCCCAGGAACCAGGGG
ATCGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACACCATGGGGACTTAGCCCCTGA
GAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGAATCTTGATCGAC
TCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCCGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCAACGGGCTGGTCTC
GGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTC
CTAGACA