Description :
From Genome Similarity Track
Location :
scaffold_76:104121- 106204
Transcript NameFunction/comments
g7367.t1hypothetical protein

Sequence
2083 bases(100 bases per row)
TGTCCAAAAGCCGATTGTACAATATCTCGTTTGAAATTATGGATTGTTTGGTGGATTTGCTGGCGGAGGCTACGCTGCTGCCCGACTTGTACGTAAACTA
CGACTGCGACGGCAACCGCTGCGACTTGACGCAGAATTTATTCGAGCTCCTTTCTCAGGTAGCACAACAGTCTCATGTTGCATGCTTTGAATCACACGAA
GAAACACATTTCCTGTGGGCCCAGGCTATTGGAGAAATCGCTCTTCGCGGAATGTTCAATGCACTGTACGTCGTTCATCTCCGTACGCACCCAGAGCCCC
TACCACTGAGTGGTGACAGCAGTGGTCCAAGTGACGAGGAGAATAACGAAGATGCGCTGCTTGTGGATCAGGACGAGCAGCTAGTACCTGCTGCTGATGG
CGACAGCTTTGCCTCTGCTGACGTATTGTTTAAGAAACGACAGCGCAAGAAGTTTTTCCAGCATGGCATCCAAGAGTTCAACCGTAAACCATTGGCTGGA
ATCAAATATTTGCAGCAAAACACGTTCCTGCCTACACCACTCGACAGTATGTCGCTTGCAACGTTCCTGCGATCCCTTCCGCAGGGCCTCAACAAGAATG
CCGTGGGCATGTACTTGGGTGCGATGGGCAAGGAGGTCAAAGGGTTTGAGAAAACCGAGATCCATGAGGCCGACACGATGGATTTCCACCGCGACGTCCT
GACCAACTTCGTTAGATCATTTAACTTTGAGGGTGAGAGTATTGTTACCGCGCTGCGGATGTTTCTCGCGAGCTTCCGCCTTCCTGGAGAGGCGCAGCAA
ATCGACCGCATCCTGAACACTTTCTCACTCCAAGTGTACGAACAGTGTCGTGAACGGTTTCTCATGGCATCCGTAGATGTAGCGTATCTGCTGTCGTTCA
GTCTGATTATGCTGAATACGGATCTGCACAACCCGAATATCCGATCCGACAAGAAAATGAAGCTGATCGACTTCATCAAGAACAACAAAAACTATGGCCA
GGAGGTTTCCAAGGGCCAAGATTTGCCTGAAGACTTCCTGACTGAGTTGTACAATACCATTGCGAAGGACGAGATTAAGACATTTGAAGACGGCGGTAAG
CACGGCGAAGTGACAAGTGATCGATGGAAGGATTTACTCAACCAGGCAGAAAGCAACCCTCGTAACTCGCGCTTGATCGTACATCACCCGTCGCTGCACC
TCCGATCATCTAGCACTCCTCGCGGCGTTGGCGTCACGCAAAATGTGTCGTCGCCTCTAGCTCCTGATGTCATGCGAACGATGAAACAAGCTCGGCTTAC
CAAGAGCGCTTCCAGTCCCGCTAATGGGTCTGCTGGTCTGTCCAAGAGGGGAACGTGGGAGCAGCAGGATGGATTCGATGGACTGGTACCCCTTTATGGC
TCTTCAGGCAACCAGTATGATCGCCATATCTTCGAGTTGCTTCAGCAAAGCCTCGTACGAGCTTTTGGCAGTGTGTTCCAGCAGTTCGTCGTTGATTCAC
AGGCGAAGGACGCTGCACGAGGCGAGGACCTCTCTGTTGGCAGCAGCTATGAGATGCACTATGTACCGCAGAAAAGTGCGCTCCAGCTTGCATGCAACGG
TTTCGTATTGTGCACGGCAGTGGCATCTCATTTGTCGCTGGTGGAGCACTGCAACGCACTGTTTATCCGCCTTTGCAAATACACGGCGCTGCTCTCGTCG
GATATTTATCCCGTGGGATACAATGGTCGCGAAAACGGCATCTGGGTGTATTGCGACAACCAAAGTGCTCCCGTCGCGACAGCTGCTGTGCTGAAGCTCG
TCAACACATGCAGTTTGTCCCTGCACAGTCGCTCGTGGAAGCATTTCTTCCATGTCGTGGGTGGTTTACGTGAATTTCATGTTCTGCCATCGCGTATTTT
GTATCCGAGCGATGAAATGAACCTGGAGCTAATGACGTCCGACGAGCGTCTAGAGTTTATTGACCTGGTGTACCAGAACAAGGAAGAACTGGAACGGACG
ATCGCGCTTAGCGCCCAAGATCAGGATGGTGGAAATGGCGATACTGGTGGCTTCTTTAGTGGTGTTGCGTGGCTACTATCAGC