Description :
From Genome Similarity Track
Location :
scaffold_36:104117- 106983
Transcript NameFunction/comments
g1673.t1 hypothetical protein PHYSODRAFT_300538

Sequence
2866 bases(100 bases per row)
GGTGACGCCATGCGAAAGTCGCGTCGCTCCGACGGCTTCTCCCGTCGCCGGCGGCGCTCCAACAGCTCCGACAATGCAACGGCACGTTCCCAAGACGCCA
ACGATGGATCTGACGTTGAGATCATCCACGACTTCCGCTCCAAACGAGAGATAGAAGCCGAGCAAGACGAGGCCAAACTCACCCCAGAAGAGCGCGAGCG
ATTACGCGACCGCGAGGAGCGTGACGCCTTCGCTGGGCGTCTGCGTCAACGCGATGAGGATCGCACTAAACGTAAGCGCAAGGCCGAGGAGCTGGAGGCT
TCTGAAGCCCCGGGGGGTCTCACGAGCGACGAGATCAAGCAACTGGCCAAAAGGGGGACAGTTGACGACGGACAGAGCGCACTTAATGACAAGCTACAGA
GGCTGCGAGAGCTCAGTAGACAGGAATATCTTAAAAAGAGGGAGGAGAAGGAGCTGGAGCTGCTGGAGTTCCAGTTAAAGGACGAAGACGTCCTGTTTAA
CGAGTCCAAGAGGTCTAAGAAGGAGCAGGAGCAGCTGGAGCTCAATAAGAGGATCCTAGAGACAGCCAAGGCAAGATCCAAGAAGGAAGAAGTGGACGGG
TATCAGATTCCTGATTCCTATGAAGAAGTGGACGATGATGGCAACAGAATCAGGAAGAGAGAGGACCTTTTGACGGACAGGTACGAAGAGGAAGAAGTGT
TCCATACTGAACAGGAAGTATGGGAAGACACGCAGGTGAAGATGGCTACCAGTCGGTTTGGAGCCAAGGATAAGCACAAGAAAGTGGAAGAGGAAGACGA
GTTTGTGTTCGACGACCAGATTGACTTTATCTCGCAGCAGATGCTCTCGGGGCATCATGTAAGTGATGAGGATGTCAAAGAAGCGAAGAAGAAGATGGAG
GAGGCCAAGCATCTGAGTATCCAGGAAGGAAGGAAGCAATTACCGGTTTATCCCTACCGGGAATCTCTTCTGGAAGCGATTCGGAATTACCCTGTCATTA
TCATTGAAGGAGAGACTGGATCGGGTAAGACGACGCAGATCCCGCAGTTTCTGCACGAGGTTGGATACTCGGAGCTGGGCATTATTGGCTGTACACAGCC
TCGACGTGTTGCCGCTATGAGTGTGGCTGCTCGTGTCGCGCAGGAGATGGATGTCAAGCTGGGGAATGAAGTTGGATACTCCATTCGTTTCGAGGATTGT
ACCAGCGACAAGACGGTGATCAAGTACATGACGGATGGTATGCTGCTGCGTGAGTTCCTGACGGAGCCGGACCTGAAGTCTTACAGCGTCATGATCATTG
ACGAGGCTCACGAACGCACTCTTAGTACCGACATTTTGTTTGGCCTTATCAAGGATATTTCGCGCTTCCGCGACGACATCAAGATTATTGTGGCCAGTGC
GACGCTAGATGCGACCAAGTTTAGTGCCTACTTTGACGATGCTCCGATTTTCAAGATTCCTGGCCGCATGTTTCCTGTGGATATTCTGTACACGAAGGCT
CCCGAGGCCGACTACCTGGATGCGGCTATTGTGACTGTACTGCAGATTCACATTACCCAACCGCTTGGAGACATTCTCGTATTCTTTACAGGCCAAGAGG
AAATTGAAGCTGCCGAAGAGATTTTACTGCAACGCACTCGGGGTCTTGGCTCTCGAATACGCGAATTACTTATCCGACCGATTTACGCTACGTTGCCATC
CGAACGCCAAGCGCAGGTGTTCGAGCCAACCCCAGAGGGGGCTCGCAAGGTCGTGCTGAGTACGAATATTGCCGAGACGTCGCTGACCATCGCTGGGATT
TGCTTCGTGATTGACACAGGCTTTTGCAAGCAGACAAATTACAATGCGCAAACCGGAATGGAGTCTTTGCTTGTCGCTCCAGTCTCTCAGGCTATGGCCA
ACCAGCGAGCAGGTCGAGCAGGCCGTACTGCCCCCGGCAAGTGTTTCCGTCTGTATACAGCGTGGTCGTACAAGAACGAGCTGGACGAGAACACCGTGCC
GGAAATCCAACGCACCAACCTCGCCAGTGTGGTGCTGCTCATGAAATCGCTAGGAATCAACGACCTGCTTCACTTTGACTTCATGGATCCTCCACCAGAA
AAGGCACTGATCCGCTCGCTTGAACAGCTTTACGCGCTTGGCGCTTTGAATGGCTTAGGCGAGTTGACGAAGCTGGGGCGTCGCATGGCTGAGTTCCCTC
TTGACCCGATGATGTCCAAGGCGCTGCTTGCTTCGGAGAAGTTTGGCTGCGTCGAAGAAGTGATGACAATTTGCGCTATGTTGAGTGTGAACAACTCGAT
TTTCTACCGACCGAAGGACAAAGCGGTTCACGCTGATAATGCGCGGATAAACTTCGCGCGCGGTGGAGGTGGTGACCACATTACGTTGATGAATGTGTAC
AACCAGTGGGTTGAGACGAACTACTCGACCCAGTGGACGTACGAGAATTTCGTGATCATGCGGTCGTTGAAAACGGCTCGGGATGTGCGTGAACAGCTCG
AAGGACTGTGCGATCGCGTTGAGCTGGAGCGCACAAGTAATCGCAGCGACCATGAGCCGATTCGCAAAGCTGTTTGTGCCGGTTATTTCTACAACACCGC
AAAGCTGGATAATTCAGGCCACTACAAGACTGTGAAAAAGGCGCAGTCCGTGTATATCCATCCAAGTTCGTGTCTCATCAAACTGGAGGAAGTCCCGCGC
TGGGTTGTGTATCACGAACTGGCATTTACTACGAAGGAGTACATGCGCAATGTGATCCCCATCAAGTCCGACTGGCTGATGGAACTCGCGCCGCACTACT
ATAAAAACAAGGAGGTCGAGGACGCCCGCACCAAGAAGATGTCCAAGGGTGTCGGTCGCGCTGGTT