Description :
From Genome Similarity Track
Location :
Scaffold_227:10410- 12474
Transcript NameFunction/comments
Physo_144647hypothetical protein

Sequence
2064 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCGAGTCAAGGTCGGATACGCTCGGAAGCTCGCTCACATGTGGCATGGGCCTTTCAGAGTCGCCACCATGGTGAGCGACT
ACGCTGCCAAGCTGGAAATCAGCGGGACTGACTACCGACTGTTCCCTATCGTACACATCTCGAAGCTGAAGCTGGTCCGACAGTTCCCCGAACGACCCGC
CGAAGATCTCACTGTTGATGAAAGCGAACGATTTGACTTTGACGAAGAACTTCTCCCCGAGGATAGCTGGGAGGCACAAACTCGCGGTGACAACGAGTAT
GAAGTTGAAGAGATATTGGATGTCAAGACGGAGAGACGCACCCGCTACGGTCGATGGCTCAAGGAATATTTGGTGCGTTGGAAGGGCCACACAGAGACGA
ATTGGGTCAAGGAAGAACACCTGAACTGTGGTGGTCTTCTGTTCGACTTCCAGCAGAAGCGACGGAGCCGGCAGAGGTTCCATGTGATGCAATCGCGTGG
AGAGGCCGACATCGCCGAAGAGTGAGGCGGTGTTGGGGGGTAGCGTGGTGGACGCTATCCGTAATGGTGGATGGTGGATGGTATTTGTTGCACATTTACA
TTTGATTGAGTGGAAGAAGAAATGGAGAGAAGATCACGCGATGGAATGGAGAAACGAGGTTAGTTGTGATGATCTGGTCGGACATTAGAATTACGACGAA
CGAGTACTCGGGGGCGACTGGGAGATCCAGCCGGTGTCGCAGTGGTCGAGGCGCCGGGGGCGCGAACGCGCGTCCGACGGCTGCTGAAACGCGCTCGCCA
CGACGCGCTGGGCCTGTGCGATGGTGAAAACCGGCACCGTTCGTGACGGAGACTACCTTCGCGTTCCGTCAATTTTGGCCGGATCGCTGTCGCCGCTGAT
TTGGAGATCCAGCCGGTGTCGCAGTGCAGGAGGCACCGAGGGCGTGAAAGCGTGGTCGGTGGTCGTCGGACTAAGTGCAGTCCTACGCCTGGAGTTTGTG
CTATGGCCTTGATCACCACAAAACACTTCCCAGAATGCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN