Description :
From Genome Similarity Track
Location :
Scaffold_1306:1041- 4787
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1306-snap-gene-0.2ATP-binding Cassette (ABC) Superfamily
Pytve_DAOMBR484maker-pve_contig_1306-snap-gene-0.3Conserved gene of unknown function

Sequence
3746 bases(100 bases per row)
NNNNNNNNNNNNNNNNCCGCGAACATGACGCCCGAGCTGAACCCGAGCGCGAGGCCGTTGACGTGCGCGCGTCGCGCGCTGGCGCGCATCGGCGGCTCGA
GCAGCGCGCCGAACGTCGCGACCAGCGATCGCTCGAGGCCGAGCGCCGCGACAGTGCGCACGTTGCTGAGCGCCTGCGACGCGTGCGCACCGGCCGCCTC
GAGCTCGTCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATCTGATGCGTCCGCACGACCTGGCCGAGGATGAG
CAGCGGGAAGACGGAGAGCATGACGAGCGTGAGCAGCCAGCTGCCGAGCGTGAACGAGATGCCGAGCGCGGCCAGGAACGTGAAGCACGCCTGCACCGAG
CGGCCCTGCGCCTCGCCCGAGAGCAGCGCCACCTTGGTCGCGTTGGTCGCCAGCGCCGCTGTGAGCGCGCCAGTGCCGTGCTTGGCGTCGTCGAAGAAGG
CGATCGGCTGCCGGCAGAGCGCGGCGAAGTGCATCGCTCGCAGCCGCGTCGTGAGCTTCTCGGCGAGCAGCTTGAACGAGAAGTGCTGCACGGCCGTCGC
GACCAGCAGCACGCCGGCGCCGCCCACGTACAGCGCGCCGTAGAGCTCCACCTCGTCGTAGAGCGAGTGCATGTACGCCTGGTCGTGCGTCGCCTGGAAG
TGCATGTATTTCTCCGTCATGGAGCTCACCATGCCGCTGATCAGGATGGCTGACCCGGGCATGCTGCACCCGACGACCGCGGCGCCGGCACACCCGAGCA
GGAAGAACCGCCGCTCGGGACTGCACATGGCCACGACGCGCCACAGTGAGAACGCGCTCTTGGACGAGGACCCGTCGCCGTCCTGCGGACTCTCGCCGTC
TATGAGCGAGGTCTCCGACGCCGCCGCCTCCAGCTTGTGCACTTGGTCGCCCAGCTCGGTCAGTCGCGATGGCCGCTCCATCTCCGACTGGCGCTCGGGG
CCGCCGGCCGGGGACTCCTGGATCGTGTACAGGTTGCGGTACAGGCCGTCGTGGATCCCGAGCAGCTCGGCGTGGGTGCCTTCCTCCATGACCCGCCCGC
CAGACAGCACGACGATCTTGTCGGCGCGACGCACAGTGCTGAGGCGGTGCGCGATCACGAGCGTCGTCATCTTGGTCTTATCCATCAGGTCGTTCAGCGC
GGCCTGCACGACGCGCTCGCTTTCGGCGTCCAGCGCGCTCGTGGCCTCGTCCAGCACGAGGATCTTGGGCTCGCGCACGATGGCGCGCGCGATCGCGACC
CGCTGCTTCTGGCCGCCCGAGAGAGACACGCCCTTCTCGCCCACGAGCGTGTCGTACTTGGCGGGGAGCCGCATGATGAAGTCGTGCGCGTTCGCGAGCT
TGGCGGCCGCTTGGATCTGCTCCAGCGTCGCGGGCGGTGCCGACGCCGACGCCGGCAGCCCCATGGCGATGTTCTCGCCGATCGTGGTGGCGAACAGCAC
GGGCTCCTGCGACACGAGACCGATCTGCGCGCGCAGCCACCGCACGTTCAGGCTGCGAATGTCCCGCCCATCCAGCAAGAGCTGGCCTTCGCTCGGGTCG
TAGAACCGCTCGAGCAGCGCGATCAGCGTCGACTTGCCGCCGCCGCTCGCGCCGACGAACGCCACCGTCTGGCCGCTCGCGATCTTGACGCTGTAGTCGT
TCAAGATGGGGGCATCCGGACGACTCGGGTACGTGAAGCGCAGACCGATCGCCTGGATCTCGCCGCGGCACTCGGTCGGCACAATGCCGACGTCGTCCAC
GGACGCGTCGATCGCAGAAGGGGTCGCTAGGATGCGGTACAAGCCAGCCGCAGCACCTCGGGCCTCGGCAACGGCCGAGATGTTGGGCGAGATCATGGCC
ATGGCCATCGAGCCGATGAGCACGCCGAAGAAGGCGCTGAAGACGTCGCCGGGTGTCGTCTTGTCGTCCGCGACCTGCTTCCCGCCGTACCATAGCCCCG
CGGCGTACATGAGCCACATGCTGCCGAAGAAGATGCCGACGACGACGGCCGTGAACTTGGCGAGCTCGATGTTCTCGTGCTCGGCGCGCTCGGCCTTGAC
TTCGTACTTGGCCATCGCGCGGCGCTCGCCGTTGTTGGACACGACGGTGCGCATGCAGCTGAGCGTCTCCTCGGCGACGGCGCCGGCCTCCGCGTACACC
TTCTGCGCGTGCTCGGTGCGCTTGCGCAGTGTCTTGATGAGCCACGAGAGCGAGAGCGCGATGAACGGGAGCACGCACGACATGATGAGCGAGATCTGCC
ACCCCTTGATGAGCCCGATGGCGTACCCGGCGACGAACTGCGCTGTGAACTTGAGCGCGTCGCCCAGCTTGTACCCCATGCCTTCCTTGATCTTGATCGT
ATCGCCCGTGAGCCGGCTCGAGAGCTGCAGCGCGTCGTGCGCGTCGTACCATCCCACGTGCAGGTGCAGCATGTGGCGGAAGCCGGCCTCGCGCAGCTTC
TTCATCTGTCGCTCGGCCGTCACGGCGAAGAGCGTGTACGACGCGTAGTCGGTCACGAACAGGATGACGGCGATGCCCACGTACAGCAGCGCCGCGCGAT
TGACGCCGTCGCCATCGTACGGCTGGAAGCTCGAGATGGCCTCGCCGAAGATCAGCGCCATGCACGGGAACAGCGCGCCGTTGACCGTCGCCATGAGCAG
ACCGAAGAGCAGCAGCACCACGTCGCCCTTGGATGCGAACCGATACAAGTCGACGAACCGGAACTTGGGGTCGACCTCGCCTTGGCTCGCCGGCGCGGTG
GCTTCTTGATCCGTCTCTGCAGCCTTCTTCTGAAGGGAATGCGTCGTCACTGTCGTCACCGCCGCTGGTGTCGCAGCGCTCTGGCTGTTCGCTATCGGAG
CGGGGTGGACGCGCTCAGACGACTCACCAGAACGAGGTGTCTGGACCACGACGTACGTCGGCGATGCTGGGCCATCGTGGGTAGTCTCCTGCTGCATCGC
GCTCCAGTTCTGCGGCGCTTGGACCTGCTAACGCCGACGCAGAGTTTGAAGTACCAGCGCTGAATGCCTCAAACGCCTCAGGGCACCTTATGATCGAGCG
CCTTCTCCCAGTCATAAATGCATCGAGCTCGTTGGACGAAACTGACCACAACCCGTTCTCAACGAGGCCGTTCTCACCGTACCTTTCGAAAGAACGCGCA
ACGCACAAAGAGCCTCTTCCTCTGCAGCGAGCGTTTTCCGTGTTATTCTCGGCGCGTCTCTTGCCTGCGTAGCCTTCACCGAAGCTGTCGACGCCGCTTG
TCGACCACTGCGACCGAGGGGAGTTCGTGGTCATCTCTCCGTTCGTTCCCCGTCAGCGCCGACGACGCCAACGGCAGCGTTACACGTATGCAGACACACA
AGCACACACCCTGAGACATTCAAATACGCGGTCATGGAACAAGATCCTAGTCCATTTCGGTCGCTTGCGCTGGCCCCGACTCGACCATGACAAAGTCTGT
TGGAACAACGTCAGGCTCGACGGCCGGTGGCGGGAGCCGATCGAGCCGCAACGCGTCCAGCTGCGCCTGCAGACTGCGCTGCATCATCCGCGCCTCCTGC
GCTTCCTGCACGAGCGCCGCCAAGTTGACCTTCGAGTACGGCTGCAAGCGCTTGACCTCCTTGATCAGCACGGCTCTCTCGGTCTTGAACTTCAAACAGT
CCCTCTCCACCACCTCCATCCCTTCCTTCATATGCTTGATACGATC