Description :
From Genome Similarity Track
Location :
Scaffold_1719:1041- 2542
Sequence
1501 bases(100 bases per row)
TCGACTTCATACTGGTTTGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCATCAAAGTCAAATCGCTGAGTCTCTTCGAGTTTGGCGA
TTAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTAGGTAGAACCTATATCCACTCTTGTCGGGTAACTC
CAATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATA
AACAACCAGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCGTCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATC
TTTTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTG
TCTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTG
GCGTCCCAACCATGCACCAGATAGAAAGGGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGT
CGGCTTGAAGTGGGTCTTCTACGTAGACCCGTATAGTCTGAACCGTTGTCTTGACTGACCTCTCTTGTTGACCGTTAGCTTGTGGTCGGTAACTCAGCGT
AGCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAACACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAAC
TGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACA
GCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCTATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGA
ATAACCTCTCAACTGTGGCTTGCTCTTACTAGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTAGTAGTCG
GCTTTGACTCGGTGATACGTTCTGACAATGCCTTGATGCCCTCCTTCGATCGAGTTGTGACAGTTATGAAGTATTTCGTCGACCATAGTTGACGAAATCA
CCAATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCTAGTCGGCGGGCTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTGAGTACAAATACTTCTGC
GACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCAAATTCGCCTCTCAGGTACGCTTTCAGATCGGCCCACCTGAGTTCTTCATCTTGTGCC
T