Description :
From Genome Similarity Track
Location :
Scaffold_26:104084- 105859
Transcript NameFunction/comments
g4274.t1hypothetical protein

Sequence
1775 bases(100 bases per row)
ATACGTACACTGGTCGAATCTGTATCGCAGTAAACCCGTACCAATGGCTGGACCTGTACTCCAAGCCCACCATGGAGAAATTCAGTGATGGTAAGCGCGA
GAACAAGCCCCCGCACGTTTACGCCGTGTCCATGGAGGCGTTTTTCAATATGCGGCAAAAGCAGGAAAATCAGAGCATTTTAGTCTCGGGGGAGTCGGGA
GCCGGCAAGACCGAGACTACAAAGATCGTCATGAGCCACTTGGCGGCGCTGGCCACCAATTCCAACTCCAAGGTCATCCAGCAGATCATCCAGGCCAACC
CGCTGCTCGAGTCGTTCGGTAACGCCAAGACTGTGCGCAACGACAATTCCAGTCGCTTTGGCAAATTCACCGAGCTGCAGTTCACGATCGAGGGCCAATT
GATCGGCGCCAGGTCCCGCACGTACCTGCTGGAGAAGAGCCGCGTGACGACGCAGGCCCAGGGAGAACGCAACTTCCACATCTTCTACCAGCTGCTGGCG
CAGCGCAAGAACTTCCCGGAGCTCGAGCTCGACATGGTGGACTCGTTCAAGTACGTGTCGTTCCAGGCACAAGCCCCCGGCGGAGACGAAGAAGGCGACC
TGAGCCGCACACGAGAGGCTCTGGAGCTTGTGGGCATTGAACAGCCATTGCAGCAGGAGATTATTCAGATTCTGGGCGCCGTGCTGCATTTGGGAGAAAC
GGCGTTCACGACCCGCAACGGAGACGTGGATGCGTCGCAATTGGTGGATCTCAAGCACTTTAGCGTGGCCTGTCGCCTTCTGGGCGTGGAGGTCGAGGCG
CTGGAGCGCGCGGTGTGCAACCGAAACGTGTTTGTGGGTCGCGAAGTGATTCTGAAGCCCATGACGCACGACCAGGCGGCGGATTGCCGTGACGCTCTGG
CGAAAAGCCTGTACTCGAAGCTGTTCCTGTGGCTTGTGGAGCAAATTAACCAAACTATTGGTGTCAAGGTGAAGGGCGCTGGATCATTTATTGGCATCCT
GGATATCTTTGGTTTCGAGCACTTTGAGACGAACTCGTTTGAACAGTTTTGCATCAATTATGCCAACGAGAAACTGCAGCAGAAGTTCGTGCAGGACGTG
CTGAAGACGGTGCAAATCGAGTACGAAGAGGAAAACATCTCGTGGTCCCACATTACTTTCGCAGACAACCAGGACGTGCTGAATCTCATCGAAGGCCGCT
TGGGCGTCATCAGTTTCCTGAACGAGGAATCGCTGCTCGCCACAGGCACGGACGCGTCGTTCGCGAGCAAGCTCGGAGCTGTGATGGAGAACAACCCGCT
GCTAGAGACTCCGCGACTGAACAAGTGCGCGTTCTCGATCTACCACTACGCTGGTAAGGTGACGTACGACGCGTCGGGCTTCCTCGACAAGCACCGCGAC
GCCATTTTGCCGGACATCAAGCAGTGCATGAGCAAGTCTTCGCTCAAGATCTTGTCGAAAATGTTCACGGACGATGTGAACGCCAGCAGCGCCAGCAGTG
CGGCACCCTCGGCTCGTGGCAGGTCGCGTAGTAGTAGTAAGAAGGGAGGCCACGCCCAGACGCGCCGCACCACGGTGGGCACCCAGTTCAAAGAGAGTCT
GTCGCAGCTCATGGAGAAGATTGGACTGACGGAGGTGCACTACGTGCGTTGTTTGAAGCCCAACCCGCTCAAAAGTGCCAACTGTTTCTCGCACGGCGAC
ATCGTGAGCCAGCTCCGCTGCGCCGGTGTTATTGAGGCTATCCGTGTGTCTCGTAGCGCGTACCCCAGCCGTATG