Description :
From Genome Similarity Track
Location :
contig_76:104055- 106131
Transcript NameFunction/comments
g10069.t1hypothetical protein

Sequence
2076 bases(100 bases per row)
CGGAATGTTCAATGCACTGTACGTCGTTCATCTCCGTACGCACCCAGAGCCCCACCACTGAGTGGTGACAGCAGTGGTCCAAGTGACGAGGAGAATAACG
AAGATGCGCTGCTTGTGGATCAGGACGAGCAGCTAGTACCTGCTGCTGATGGCGACAGCTTTGCCTCTGCTGACGTATTGTTTAAGAAACGACAGCGCAA
GAAGTTTTTCCAGCATGGCATCCAAGAGTTCAACCGTAAACCATTGGCTGGAATCAAATATTTGCAGCAAAACACGTTCCTGCCTACACCACTCGACAGT
ATGTCGCTTGCAACGTTCCTGCGATCCCTTCCGCAGGGCCTCAACAAGAATGCCGTGGGCATGTACTTGGGTGCGATGGGCAAGGAGGTCAAAGGGTTTG
AGAAAACCGAGATCCATGAGGCCGACACGATGGATTTCCACCGCGACGTCCTGACCAACTTCGTTAGATCATTTAACTTTGAGGGTGAGAGTATTGTTAC
CGCGCTGCGGATGTTTCTCGCGAGCTTCCGCCTTCCTGGAGAGGCGCAGCAAATCGACCGCATCCTGAACACTTTCTCACTCCAAGTGTACGAACAGTGT
CGTGAACGGTTTCTCATGGCATCCGTAGATGTAGCGTATCTGCTGTCGTTCAGTCTGATTATGCTGAATACGGATCTGCACAACCCGAATATCCGATCCG
ACAAGAAAATGAAGCTGATCGACTTCATCAAGAACAACAAAAACTATGGCCAGGAGGTTTCCAAGGGCCAAGATTTGCCTGAAGACTTCCTGACTGAGTT
GTACAATACCATTGCGAAGGACGAGATTAAGACATTTGAAGACGGCGGTAAGCACGGCGAAGTGACAAGTGATCGATGGAAGGATTTACTCAACCAGGCA
GAAAGCAACCCTCGTAACTCGCGCTTGATCGTACATCACCCGTCGCTGCACCTCCGATCATCTAGCACTCCTCGCGGCGTTGGCGTCACGCAAAATGTGT
CGTCGCCTCTAGCTCCTGATGTCATGCGAACGATGAAACAAGCTCGGCTTACCAAGAGCGCTTCCAGTCCCGCTAATGGGTCTGCTGGTCTGTCCAAGAG
GGGAACGTGGGAGCAGCAGGATGGATTCGATGGACTGGTACCCCTTTATGGCTCTTCAGGCAACCAGTATGATCGCCATATCTTCGAGTTGCTTCAGCAA
AGCCTCGTACGAGCTTTTGGCAGTGTGTTCCAGCAGTTTGTCGTTGATTCACAGGCGAAGGACGCTGCACGAGGCGAGGACCTCTCTGTTGGCAGCAGCT
ATGAGATGCACTATGTACCGCAGAAAAGTGCGCTCCAGCTTGCATGCAACGGTTTCGTATTGTGCACGGCAGTGGCATCTCATTTGTCGCTGGTGGAGCA
CTGCAACGCACTGTTTATCCGCCTTTGCAAATACACGGCGCTGCTCTCGTCGGATATTTATCCCGTGGGATACAATGGTCGCGAAAACGGCATCTGGGTG
TATTGCGACAACCAAAGTGCTCCCGTCGCGACAGCTGCTGTGCTGAAGCTCGTCAACACATGCAGTTTGTCCCTGCACAGTCGCTCGTGGAAGCATTTCT
TCCATGTCATGGGTGGTTTACGTGAATTTCATGTTCTGCCATCGCGTATTTTGTATCCGAGCGATGAAATGAACCTGGAGCTAATGACGTCCGACGAGCG
TCTAGAGTTTATTGACCTGGTGTACCAGAACAAGGAAGAACTGGAACGGACGATCGCGCTTAGCGCCCAAGATCAGGATGGTGGAAATGGCGATACTGGT
GGCTTCTTTAGTGGTGTTGCGTGGCTACTATCAGCCCTCGACTCGAATCTCGGCGGCTCGGCACCGGACTCATCGACACCAGCGAAGTCGCATCTTTCCC
CTGGTTTTGAGCAGTATCAGCTAAGCCCAGCAGAGTTAGCCTCGCACACGGAAGACCTTGTGATCGAGGGAACGACTCCAAACAAGCAGCCATCCGATGG
CGAGAATGACTCGAGAGGAGAGTTTGGAACGGATCGGTGGATTCGAACCACATTGCAGCCTTACCGCCTTGAATTT