Description :
From Genome Similarity Track
Location :
Scaffold_152:10405- 11616
Transcript NameFunction/comments
Phymu_g5599hypothetical protein

Sequence
1211 bases(100 bases per row)
TTTGGGTGGGGTGTATTGGATTGGGAACGGGCTATCTCGGAGCTTATTttgttgtcgttgttttAAATGGCAGGGTTTCGATGGATATACGGCAAGTTAC
TGGGCAGAGTTTTAATCTGCATGCGAACGCCTTGCTCCTCATCAATGGTCACGATACGCGGCGCAGATAGAGTGCTGCCAGCCTCggatggagcagaagc
tggacCAGCCGTCAGTAGTTTAGCTTCAACTCGCTTTGTGATCGCTGATACTGAGCGAACAGAGTGCACCGACCGAATCGACTTGCACTCTGATAAAACA
CTGTTCGCGACACTCATTGCATCGTCATCCTTCGCCTCTGCACAGTCCCATCCGATCCGAGACAAATCGTTCCCGTTgagagctccaccgccgtTGGTCA
ATTCTTCTAGTCGTTGCTGCTCGCGTTCGTAGCGTTtctcttcggcttcctcgtAGTCCACAATAGACTGCACCTGTgccaactgctgctccacctGAGC
GACTCGTGCCTTGATCTCCACATCGTCCATAAACTGATCTATATCCAGATTGTTGGCAAACTCGATCAGATCATTCGCCTCGGCATCCTCCAAGCtgtcg
agcttctcgtcggcaGTAGCCTTGGTAAGTGCCCACATGGGTCGATTCAAGTTCCTTTTCTTCTCTCCAGCGGGCCCAGCATCCTCGTCACCTTCGTTGT
TACTACAAACTGCCTCACGCATCTTGGCTTCTCTCTGTGAAAATCGTTCTTTACGCTTTTGAGCGGCTTGTTCGTCTTCCGCTAGAGCTTCCTGCAGACG
GCCACGCTCCTTCTGTAAATCATGCAGCcacttcttgtgcttcgacaacgccgtgttcttcttgtcacGACGTATAGCGTGCTGCAAAGGAAAACAAACA
GCTCAGAAAACAGTCGAACAtgaaaagaagaagcaggtaACCAACCCACCGCAGGCTCACTCAGAATGGGCACGTTTAGTCCCAGAGGTTCGCCAGGGTT
ACCGGCCAGAAACGCTGCCTTGCTGTTGTCGATCACATTGTTGTCCGCCTTGGCACCGTATCGGACCTCCTTCGCTAATGCTGCTCAaagaagcagtaca
agaTCAGGTTCTGACGCGGAAAATCGTTCAAGAACACGGTCACTTACTGCTGGAAACCCCGTTGAACGGCCGATTACACAGCATTACGCCCTTGTAGTTG
CCGATGCTCAC