Description :
From Genome Similarity Track
Location :
Scaffold_684:10405- 11424
Sequence
1019 bases(100 bases per row)
TTCCCGCTGCCAGACAACTACTTCCCGGCGCTCGACTTGTCGGAGGCACAGATCGCGCGGTATGAGTGGCAGATGCGCGAGATCGTGCAGAGCGCGCTGG
TCGAGTACAACCTGCACGAGGTTTCCGAGCCGCTGGCCAGCCACGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGGCCTGACGACCATC
CGACCCACCGCCGCCGGCACGAAAGCCAACGAGCTGCGCATCTTCGGCCGCATCAACGGCGATTACCGCAACTTCATCGACTTTTTCTACTCGGAGACGT
CCAAGCAGCTCTTCGAGTGGAACCAGATCATGTTCGGCAACACGGTCGACGCCGCCGTGCTGGCCAACATCCACACGGCGGCCTCGCACCGCCCGCACAC
GTACATGGGCGTCAAGTGGGTCTGCCTGCAGCCGTCGTCGTTCTCGCGCAAGCGCGACCACTGCTTCCTTGAGTACATGATCTACACCAAGGACCTCAAG
GGCCGGGACGTGGGCGTGCGCGTTACGCTGCCGCTCGATATCCCCGAGTGCCCGCCGTTGCCCGGCCAGCTCAAGACGGCGCGCATCAAGATGCACATCG
TGTCGATTGCTCGGCCCGCGGACGACAACTCGTCAGCCACGCAGCTCTTCATGATGTGCGAGAACGACCTGGCTGGCTTCCGCGTCCCCAAGGTCTTCCT
CAAGAAGATCATGTCCACACTCGCGAGCATGACGCTGCTCGCCGACTCCAAGCGCCTCTCCATGGTCTCCTTCGCCTCGCCGCGCGAGTGGGTCAAAAAG
AGCTCGCGCCGCTCGTGCCGCATCTGCTCTCGCGCGTTCCACGCCACGCGGCGCCGCCGCCACTGCCGACTCTGCGGCGACGTCTTCTGCCCCACCTGCA
CCGTCGAGCGCGAGGCACCTGTGGTCGACTCTGCGCACCGATTGCGCACCGACTTCCAGGCCGTCAAGACGCGCTTCTGCAAGATGTGCGTGGCCAACAT
GCGCATGTCGGACATGGCG