Description :
From Genome Similarity Track
Location :
scaffold_379:10404- 11946
Transcript NameFunction/comments
Pl_105440conserved hypothetical protein

Sequence
1542 bases(100 bases per row)
TCACGCTACTTGTGTCTAGCTTACTTTTAATTTCACCTCTAGTTCTAAGTGTCCGCTATTTTGCGTAGCTCGAGGAATCCAAAGCTCTAAGGATCCACCT
CCTGTGCCAGGAAGATTTAAAAAGCCTGGACGCCATCGATCCAAGTACAATGTTTTTCCTCCCAGCGCGGTTACATTGGACTTCCACGTCGCGGAGCCAC
CCGCGGAGACATCCACCTTATCGATTCTCTCCCCGGCGGAATGAATATTTACAGTCACGTCCTCTGTATCCGTACTTTTAAAGGCGATGATGACCGTACC
ATCGCCTTCTTTTGACCAAGTGCCAGAGCTGCCATTGAAAGCTTTGCCATCCAAGGTCAATCCCAACGAGTCGTTTACAGGACCATCATCAATGTCGCCG
ATAAATTTCGTTGGACCGCAAATTGTCTGAAGATATTCACCGATAACATTGCCAATGCCCGTGATGTCCCAAACACCGTAGAAGGAGGCCGCCTTGTCGG
CAATCTTTAATGCGTAGTGTTCGGCAGACAAATACGTTCCGTTATTGCTCGTCCCAGACGTAATGAGGTCCTCCACGATGACACCTAATGTTGTTCGTAA
GGTAGTACGAGTGACATACGCTTTGGTCACACCCGACTCGGCAATCAGCTCCTCCATGCAATTGTTTGTTGCGATCGGAATATCATTCAACACGAGGTTC
GACTTGCTCAGGTAAACACGCAGCTCATTCTCGGACATATCAGGGTTCTGTTTCCGTAGACCCAATATGGTCATCCACGTACGATCAGTAATACGCTTCA
TGTCGTAACCGCAGGTCGAGTTGGACTTCATCACAGACTGCAGTGATGTGATCTCGGTGTCTTTCAAGCCTGAAATTGACTCGCCGAGTGCAATTCTCTT
CATGAAACCTTTGAACGAGTCCCAACTTTCGACAATTGCTTCCTTATCGGCAATAACTTCCCTCAGGATGAGCTCGGCAGTATTGGTCATCCTGTCATAG
ACTCTAAGGTCAGCTCCGATAACGATTCCCATACATTCTGCGATCGCCACGGGGATATCAAAGACTACGTTGTCGGTCTGATAAAGCTTATACAATACCT
TATCATCAGTGGTTTGTGGATCCATCACCATAACATTGCGGACGTATTTACTGAGCTGTTTCACCAAATTCGCCATCTCTTTAGCGCATCTGAAAGCTGT
CCTAACAGCCTTTGCCATCAACTTGAACTCTCCGTACAGATTAAACAACGAAAGCGCCATAACCGATTGAAACACATACGCAACCTTGGACACGATCTCG
AGTTTGCAGTCGTCATTCTGGCGGATGCATTCCATTCCACATTTGACCGGGAACTCCATCGGACATTGTGCCCAGCACGTGCCCCATTTGCTGTTAAACT
CAAGTGGACAGGTCTTGCCGATGTGAGATTCGCGGTAACACGCAGTGTCTGAAGGTCTCGTTATTGGACCCACCCAGTTCGGGTAGGTGGACTTGAATGT
ACTAACTGCCGTCGTTGTTGAGTCAATTGTAAACTGCCTCGT