Description :
From Genome Similarity Track
Location :
Scaffold_926:10403- 11924
Sequence
1521 bases(100 bases per row)
TTACTGTACACTTTGCGCTGACTTGTGTCCTTGTGGGGTCGACTTGCAGTGCGACACGTCGGATCTCGACTGCAACCCGTATTTGTCGATGGCGCTCTCC
TGGTTCAAGTGCGCGGGGCTGGTCAAGACGAGCGTGCAACAGACGTACGGTCGTGTAGCGCCGCACAAGCGCTTTTCGAACGCCAAGGACGAAGTAGTCG
TGAGCATGGCTCAAGAGCTCTCCCGACCTGCTCAGCGAGGTCCCGACGCTCGACTATGCGAAGAAGATCAACAAAGCGTGGGGTGCGGATGCAGTGCAGT
CGACCAGAGGTCGACGTCAATGCATACAGTGTGCGTGCTGATGAATTTGCTACGCCAACACGCCCGGCGCGCCCGAGCGCAATTAATAGGAGTAAAAGTA
AGTATGCAAAATAGAGAAGGGAGAGTTTGTTCGGTATACAGTATATAGCAAGTTTTGTCTGTTATCGTACGCTCTTGGTCAATGCCCTGATGATCGCAGT
CCGTTTTTAGGTGTTAAACTTCCCAGTCAGTGACATGACCTGCTGCGGTCTATTTTTAATGATCTGCTTTGCCTATACTATAGCGCCTCTGCTCCCTCCC
TACCAAAATGCAGTTTTTCATCTCTGACTTGCATGTTGGAGGAAAAGACGTGTGCATGTTCATGCAAAAAGAGCTCGCGTGCAAGTTTGATCAAATGTGC
GCGTGTATGTTTACAAAAGAGCTCGCTGATATGATGAAAGATCGTTATAGAACTACCAGCTATTTTGTACCAGGAAGTCACTTTCCATGTGTTTCGCATG
CTTTATTGTGTGCTTTGTGTTTCGCCTGTGTGTTTTGTTCAGTCATGAGTGGGCTGGTGCGTGTTCGTGGGTGGGTGGGATTAGAACGTGCGTGTGTGGA
TAATGCTGTTTTACGTGTGGCAAAAGAGCACGCTCCAGAAAATGTGATGCACGTTTTGTGTGAATAGCTTGGAAATATTTTTTGATAGTGGATGATTATA
TCATCCACCGATAAAAATAACGTTGGACAAAACGCTATTGCTGGGTCTAAATACTGTTAGAGCATGCACAGTGGTTCTCCATAAACTCACCATAAATATG
TGTGAAAGCCGCAGTTATAGCGGACTGTAGCCGAGGTATAGTTTTTTTTGTCTGCAGCGGTTTCCACGCAAACAAGATAATAATGCTTCCACAATCTCAT
TTTGCGCCTATTTTTGGTGAATTTGGAGTGATTTTGACCTATTTTGATAGATCAAAATTACTCCAAATTCGCGGTTTAAAAAAACACGCACCCGGATACC
GAGATTGGGCTCATATTGACGAAATAGTTGCACAGCTGTGTGGCTGTTCAAAAGACAACACTTCACAAACACTGGACTGTTTCCTGTAAGATTCTAAACA
TTTCAGATGTCTAAAATATTCATAAACAGCACCTTTTCGTTATTAGACAGCTTGTCAGAATTACCAATCTGAAGGACCCCCTCCCCCTCCTGTAAAATCT
AGAATAGGGTCGTTCATTCCT