Description :
From Genome Similarity Track
Location :
Scaffold_893:104- 7119
Transcript NameFunction/comments
Physo_145286reverse transcriptase
Physo_145287hypothetical protein

Sequence
7015 bases(100 bases per row)
CAGCAGCAGAGAGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCGAGCTTGAAGCGTCCGAATCGTCCGAATCGTCTCCTTCACGAGGGCGTCTCGACCC
GGCATGCGGGTCGAGACTATCGCTGTCGATAGACTCCTTGCACTTGCTAGAAGAGGCTTCGCCCTCTTCCATCTCCACGTCGCCGTCCTCGTCGTCAACG
GCGTCGTTGACTACAGAGGAACCTTCGAGGACAATCTCCGGCTGGGTTGTCCCCGACGCGGCCTTTGCAGCGAGCGCGTCGCGCTTTGCCTGCTGGCACT
CATGGTACTGAGCAACAGAGAGGCTACCCTCTGTTGCGGCGGCTGTCTTCTTCTGCGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAAC
GTGAAGAATTGACGAATGGTCAATTTCCTGATTGACGTGCTGTGACTCGGCGCGTCTAACCTTGAGGGGGGATGGTGTAACAGGGTTACACGCACAAGTG
GCTACAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAGGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTAC
GACCACCACGATGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCC
AACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAACATTAT
TTGGATCGTTTATTTAGATTATCTATACTCGGAGGCCCGAGTATAATTAACTCTAAGTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTA
AGCTAAAGTAGTGAGCCAAAGTAGGCCCACTACACCTGGTAGCACTTAGTAGTCCGTCCAACGACCGACTACCTGAGTTCGTACGTCATCGCACGAACGC
GGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCACGCGCTGACTGTCCCCACCTGCCGGACC
CAGAGTGGGAAGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGAACGCTAACGCCGACAGAGCAACATGGTGTTGC
TCTGGGATTTATCATGAGGGAGCAGCGAGATGCTGCTTCATCTACCACGGTGTCGTCGGGGACGACACCGCGCGCGCAATCGCTGAAGCTCAGGGTGAGC
AATTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCATTGCGGCTCGACGCATCGTCGACCCGTTGTCGAAGGTCG
CGTTCGCCATGTCATGTCTTGGCGGACGTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGTATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGTTTCT
ATCAGATTCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAA
CGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGGGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCT
GCGGACGGGATGAGCGATGTTGAGATGCACAAGGTACATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCA
TCTTCGGGGTGAGCGGGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCGGAGAAGGTCAGAGTGATCAATGAGTGGCCGAC
GCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGTAAGTACGTGAAGGACTACGCGGACATGATACGCCCGCTGTCACAG
CTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGAGCTTGACTGAGGCGCCGATCTTGGCGGTGG
CCGACCAAGATCGCCCATTCCACGTTGTGTGGGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGT
CTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGAAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTG
TATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGTTACGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGC
TCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGA
CTGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCCCG
GGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAG
ATGGTCCATCTTGCTGCAGTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACA
TTGTGTCGGATCAGGACCCGCGCTTCACTGCACAACTTTGGCAAGAAGTGCACTTCTTGGGAGTCAACTTTCGATGTCGACCGCGGACCATCCGCAGACG
GACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAATGCCTGCCGATGGCGGAGT
TCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGC
TCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAAG
AAGAAGCACGCGTCTGTGCAGAACACAGACGCCGACAAGAGCAAGAAGAAGAAGAAGATCGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAG
AGGCCGGGCCTACTGCTAGAAACGAGCTGAACTCGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGC
TATTGCAGCTTCTGTCGACCGACAGAAGCTTAACGCAGACAATGTTGGTAGGGGCAACACTAATGGTTTCAAGAAGGGTTCATTGGTTTTGTTAGCAACT
CAAAACCTGCCTAAACATGCCGTTTCCGATTTCGGGGCGAGCAAGCTCGGTCCGCGCTTCATCGGACCGTTCACGGTGTTGGCGCGGCATGGAAACGCCT
ACACGCTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGGCCC
GAAGCGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAACGCGTGAACGCGCTGGACCAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACG
CGGTCTGCGAGGCCTGAGCGACTTGAGCCCTCAGGATCGCCACCTCCTGCTTCAGAGCGGCGAACTCCCGGCTCTGATGCTGTTCCACAGCAGCGACCCG
CTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTAGACCATACCCGGGGCGTGTTCCCACCACCGCTGCCTCCGATCCACGACGCCCGCGGCTCAACACG
CTGGATTGTTGAGCGTATTGTGAACCATAGTATACCGAAAACGAGCCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACAAAGAT
ACATGGGAGCCACGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGAGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGTG
TGGTCACCTACAGCGCCCGAGGTCCCACGATCGTCGCGTTCCTCACGTGCCAAGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACACGAATCGTCG
TATACCCGTTAAGGTCGCGGTCGCTCAAGCGCGCCGCACCCGGAAGACACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGAAATACCAGCGTCCAC
AGAAGATCTGTGGAG