Description :
From Genome Similarity Track
Location :
Scaffold_989:104- 5107
Sequence
5003 bases(100 bases per row)
GCCATCCAGCGACGTCCTTGCCGTCACtCTTCCTCCACCTGCATAGGGgAGAATCACCGCATTGCCCTGACCCTCGACTCATAGTCCTCCAAGAGGCTCG
GTGCTCGCAGATCGTCTTCGCTGACCCAGCTAGGctCGTCGTAGCCTTTCCATCGTACGAGGTATCGCCTCGTGACTcGCCCCTGACGAGCGGCTCGGCC
TATTTCGTGGTCCAGGATGGCCTCGATCTCGTAATCACCGTCGTCTTCGTTCGGCTCGAATGAGTCTtCAGGCAAAAGGGCCTCGTCGAAGTCGAGACGA
TCCTCACTAGCCAGTTCGAGTTCACCTGTTGGCCGTCCACTATACTCCTTCCACAAcTtCAGGCGAGAGACGTGCACCACGGAGAAgATACGATAGCCGG
TTCCTTCGATCTCGAGTCGTACCACGTGATCGGCAAGGCGTTCCAGCACCCTGAAAGGGCCGTGCCACAGGTGGGtGCTCTTCTTGGCATATCCTGGCCT
CACTTGGTTCACATACACCCAcACTCGTGCAcaTTCGACGATCGCATCAGCATCTCCTCGCCTCTCGCTACTGGCTTGAtcACGTCGTTCCTCCATAGtc
GCACGTAACAgTCGGTTGACATCTTCTCTGGCCCGCTGATACTGAGCTTGAAGACTtGATCTCCACTGTCGAGCgTCTCGGTGTCGTCCTCGCCcTTCCG
CTGTCGGCAGAGCCACTTCGATCGTCGTCCGTGGTTCCCACCCATGAaGCAGATAAAaCGGAGAATCActCTTtACCCGATCGTAAGCGGTGTTGAGAGC
TAGGGTGATGCGTTCTGCATAATTATCCCAGTCTCGCTGTTCGGGACCTGAGACGTACTTTGACAGCGTTTGTGATCGTCTGCACCATTTGCCCCGTCAT
GCCGTTCGACTGCGGGCGATAAGCCGGAGTCGCCTTGCTAGTGCCCCGATGAGCCGATTGAAGCACCGAAACACTTCTGACATAAACGCAGGCTCGCGAT
CGTGTCTGATGATCTCGCTcGCCCCCAATCGCCTATAGATAGCTCTCTCGTAGGATTCCGCGACTTCTTGGGCTACTCTGCTGCGGTTGGCGCTGACGAT
CACGAAGCCTGTGTGCTGATCCTCCCAGATCAGTAGCTCCGAGTTCCCCCGATGTGACCTTGGCAGCGATGGTATGTGGTCCATGCCGATCATCTGGAAT
GGTCTCGTCGCTACAATATTGCCGGGgTTGGGGACCACGATTCGAGGTGCTCCTTTGTCTGATTGGCAGTCGCTACACGCAGCCACGTAGTCTTCTCACC
CCTTGGTGACCGCCATTCAGACTCGCGTAATAGTGACAGAGCGCATCCTTCCCCAGCGTCGTCGGAAGAACTAGTCGAAGGCTACTTTCTCGACCGATCA
CCTCTCGCGACTTCCGGCTCCCCACGTAGTACAGCAGATCATCGACGACCTCGTgaTGATTGGCCTTCTTCGACGCCTTCTCTGTCgtACCACCTGTTAA
GTCTGCGCCTTCGCCCGTTATCCACTTCTTCAGATCCCTGACCCATCTTTCCTCATCTTGCGCCACGCAGATTCTCTCTGCGCGGAGCCGACGGCGCCGC
CGCgCCcGcGTTGTAGGGCCTTCCCTGTGATGAGGTCTGCTGCCCCGTTGTACTCCCGTGAgACGTGAACGAGACTAACANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGACCCGCCAAACAAGATATCGTCAATGTATGATCTCCTTCCGATGGC
TGGGCTCACCTCAGATCCTGCTGGCTCGCACTTGTCGAACAAGTCGATCTCCTTGTCCTCTCGTAAATGCTCAGGCGTCAGCTTTAGATACCCGTACAGC
GTGTTGTCCAGCAGTCTCTGGTAGATCTGAGGAGCGTTTTTAAGCCCGAAGGGCACCTTCAGCCACTCGAACAGCCCAAACGGCGTGATGAATGCTGAGA
TTGCACGTGCGCTTGCCGTCACTTGACAACCCAGAACCCGCTCGCCATATCGAGTGAGCAAAGCcACTGCAGTGAACCGAGGTCCTCGAGTAGATCTTGT
ACTACCGGCATCGGATAGATCATCAATCTTGTCAGTGAGTTCACCACTCGATAGTCGATACAGAGGCGGATGTCCACGCCGTTTTTCTTGATCACGATCA
CGATGGGGGAAGCCCACGGTGACCGAGATGGCTGGATGAACTGGGACTGTAGCAATCCCTTCAGGAGCTTGTAGAGCTGCTCACTGAACCGTGGAGGCAC
CTTCCTGCACGTTTGTGCAATTGGCTTGGCATCTCCCACGTCAATATCGCAGACGACTCCCTTGGCCGCCGGCGGGCGGGCATTACCCTTCCCCACCAGG
AACGCTCTTCTCTTCCAGACAATGTCTCTGACTTGCTCGATCATCTCTGAGGGTAGATCTTCGCCAACCGCTACCTGGATGTCTTCACGGCGGATCTCGT
CACTGGGgTTtACCTCTCGAATGATGGCCACCTGTCCGTCGCGATCTTCAGCTGTAATGTCGCCTTCCTCGTTGACGAACACTGCATCATGCAACCGGGA
AtCTTCGACGATCAGCTCCGCGATCGACTTCGACGTCACGAACGCAATGGCTGCTCATGCCCAATACGCCTTATCGTCGCTTGGTGCCTCGGGCCCGCCG
CGTATCACCTCCTCATCGCCCAAATCACCGGAGACGCTCCTGCCTGGCCGACTTAGGATTGCCTCGGGAGTCGGATACTCACGCTTCTCCACTATCGGGG
GGTCgTCTGCGGCCATAGTGGCAGCCAGTGCTCGTCGTCGATGGCTCAGGTTCGACTTCATACACAAGCGTACACCACTCGTGGTACCGTCGTGAGCCGA
CCGAGACACATCTGGCTAGACGAGGAACTGCCTCGTAACCGAGCCACATTCCCACGACCGTCTGGGCCGATATGAGGGTAGTCTGACTCGATACGTTGGT
GATCTTCACTTGGATCGGCTTCCCTTGAGCATTAAGCTCTACCGTTGGCACCCATGCATCTCCTCTTCGGAGCCACAGCTTCTTCCGGTTTGGTGGCTTG
ACCCGTAGATAGATGGAGCTTCCCACCGCGAGGGTAGTGTCGCCTTTCACCCGGATCTGCTCGACCTTCTCACTGTACAGGGGCTTCCGGCCCTCGAAaC
GTACCCTGATCTCGTCAGGCATCAAAGCGACACCTTCAGAGAGATCGAGGCGGATCCCGGCTGGAGTTAGGAAaTCGCAGCCGAGGATCGCGTCCACGTT
ACCGAGTTTGCCGACTCATACTTGGCACTCATAGGCTAGTTCATGGGCAAGTGTCACCTTGACCCACGCCTTCCCTTCTGTGGTGAATGCCGATCCTCCA
ACACCTTCACAACCTAGCTGCTCTGATCGGTCGACCTTGATGCCCTTCTTACGCGCAAAGTTGGCATCCAGGATCGAGACCTCCGCGCCTGAGTCCAGTA
AGACTCTAGCGTTGTGACcATTCACCTgaGCAGCGACAATCGTCTGGCGATACAGCTTCTGAGAGTAaTATCTCCAATATCCCCGTTGCTCTCCTGGGTG
AAG