Description :
From Genome Similarity Track
Location :
Scaffold_114:104- 4700
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_114-snap-gene-0.19Gene of unknown function
Pytve_DAOMBR484fgenesh_masked-pve_contig_114-abinit-gene-0.87Major Facilitator Superfamily (MFS)
Pytve_DAOMBR484maker-pve_contig_114-snap-gene-0.20Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_114-fgenesh-gene-0.0Major Facilitator Superfamily (MFS)
Pytve_DAOMBR484maker-pve_contig_114-fgenesh-gene-0.9GMP synthase [glutamine-hydrolyzing]

Sequence
4596 bases(100 bases per row)
AACCAGACCGACAGTGAGATATCGAGATGAGCACTGAGATCGCCAACCCGGATGCGATCCCCTTGTTGCTTATACTGCATTACATGACGACTCTCGAGCT
CCGACACCCAAACTACGCGTCCACAGCGTTCGAGAGCACTCGAGCGCGAGCCTTTTGCCGCCGACGGACCACAAACAGCGCCGCTCCCCACAGGAAAACG
CCCCACACGAGCCACAGCACCGCGAACAGCAGCACGTACTTCAGGCCGCTGCGGTCCTTGTAGCACTCGGGGTTCAGGTGCGCCTCGCCGTCGATCTCAA
CCGTGCCGCATCGCGGAGCCCACGAATCCTTCAGAGCGCCGAGGATGATCGGGGACGGCACATCGCCGAGCGCGTGGATGAGCATCGTGTTGGCTGAAAT
GGCCATCGCGCGCTGGGACTCCGGGAACAGCTCCAGCACCGCGACGGTCTCCGGCACCGAGAGAGCGCACATGCAGAACAGACAGCCAGTCAGGAACACG
AGGAATATGGCACGTTGGCCAGCCACCGACACCATGATGAGCCCGAGAACCTCGGCCGCGGCCATGTAGTAGAAGAGCGAGGCGACGGCCACGACGCAGC
GGCGACCAGTCAGCTGGCTGCCCTTCTTGGCGATCCGGTCGACCAGCAAGCCTCCGATCGGCGTGCCGATCGTGCCGGTGATCGCGACGAGACCGCCGAA
CAGCAGCGAGACTGTCGTCTCGCTCGTGAACAAGCCCAGACCGATGAAGATGGCCGGACTGAACGTGCTGAGCGCCGCGAGCGAGAATGTGTACGCCGCG
TGGCCGAGGATCACAAGCATGAACGGCACGTTGCGGAAGATCTCCCACCACGCGGCGAAGAACGGACGCGACGTCTTGTCCGCGTCCAGGAACGCAGTGC
CGCTCATCTTGGCCTCGCCGTCGGAGCGGGTCGAGAGCAGGTCGTTCGTGAGCTGGCTGGGGGTGTCGTTTGCCTCTGCTTCAGCCACCTTGTCGCGCGG
CACTTGGTTCAAATCAGCAGGCACGCACACGAAGCTGGTCGAGACGAGCACGGCCATGATAATAGCCTCAAGATAGTACGCGCCGGCCCAGCCAAAGCCC
GAGTTGGCAAACAGCGAGCCGTAGATGTACCCGATGGCCGTGCCGACTGTGATGGAGGCAAGGTAGATGCCAAGGTAGAGTGCGCGGCGCGCCGGCGGCG
CGTGGCGGTTGATGAAAGGCGTGGCTGTGCACTGGAACGAGGCCTCGCCGACGCCGCTGATGACACGGCCAATGATGAGCACGTAGTAGCTGTCGGCGGA
CTGGGCGATGCCGCAGATGATGACCGCAACGATCCAGATCCCCATGCCGATCGCGATGAGCCGGAACGGCCGGTGCGAGAGCGCGAGGTAGCCGAAGACC
ATCGAGAAGACCGAGTAGCTGGCGATGAAGGCCGACTGGAGCAGCCCGAAGTACACCGACTGCTGCAGCACGCTCACGCCCAGTGTCGACGAGATGAACG
TGTCGAACTTCTCCGGCGCGCCGGGGATGATGCCGCGGTCGACGTAGTTGAGCAGGTTGATGCAGCAGAGCAGCACGATGACGCCCTGCGGCCCCAGCTG
ACGAACGTTCATGGCTGCGGACGTGCGGGACGCTCGCGCGCGGAGGAACGGCTCGGCGAGCAGCGCCGCCTTCTCGTCGTCCTCGTCGTCGCCGCGGGTG
TCGCGCGGCGCCGCTAGTTGGGATGTGGGCGGCCGCATGGCCAGCGTCGGCGCTCCAGCCAGGCGGTGCTGGGACGCGGAGGGAGCGGGGGAAGATGCGG
CGGCGGCGGCAGCAGATGCCGGCGGAGTCGCCCGTCTCTTTCCACGATGCATATCGGCTCGGTCCATCGCGAGATGATTTGCTATGATTGGCAAAAAACG
ACACGCACTTAGAAGAATACAAACCTCCAGTCAAAAAGTTGGTGGATCGAACTTAGTGACTCGCATGCTGGGCGAGTCATGGCAGGGGTGTACTCAGCCA
CTCGACATGACGACGCCTCGCACTGCTTTCCCGCAGCTCAGTCACCGAATGAACAGTGTACAGTGCTGAGCTGAGGATCAAGCGCGGCCCACTGTGCCCG
TGGCATTGAGAGTGAGTGTCGGCAGCAAGGAAAACAGGGGCAACCGCTGCACAGCGAGCATTGAAACCAGCGGCAGCGACTGCAACACAGTCCCCTGCGC
TCGGTGTGAAAAGCAGACGTGCGAAGCCTGTCTTTGGTCGAGTGGCCGTGTGAAACAGCTCGTAATCAGGCGTCATCTGAGCGCGGGGTGAGTGTCGGGA
CAGCGGATAGACGGCGCGCCGCCAACGAAAGCGCGGGTGCGTGGCGCAGGACGCTTGCGCGTGGCACCACACCAAAGCTTGGTGCGACAAAGAGTAGCCT
CCGGCTCAGTTGGCATTCTTCGCTCCTCCAGCCAAGATGATTCCAGCACCGAAACTCGGATCGCAAGGGATCATTGTGATGCTCTGCTGCATCAACCTGA
TCAACTATATGGATCGCGGGATCATCTCCGGCGCGCCAGAGAGCTTCCGCCATTTCATCACGAGCTCGCTCGGCGTACCCGTCACGAACCAGACGGTCTA
CTTCGGCCTACTCTCGTCCGCCTTCATCATCGGCCACTCGATCCTCTCGATCGTCTTTGGCTACTTTGCGCTCAAATGCCGGCCGTTCCGGCTCATCGCG
CTCGGCATGTCCATCTGGATTCTCGCAGTCATCATCTGCGGCATCTCCAAGCCGACCAATAGCTACGCCGTGCTCGTCGTCGGTCGAGTCATCAGCGGTG
TTGGCGAGGCCTCGTTCCAGTGCATCGCTCCTCCGTTCATCGATCGCCATGCGCCTGCTGCTCGCCGCTCCTTCTACCTCGGCATCTACCTGACGTCGGT
CGTCGTCGGCGGAGCGATCGGTTACATTTACGGCTCGCTCTTCGCCGACTCGGTGTTCACATGGGCCGGCGCGTTCTACTTCGAGGCGATCATCATGGCC
TTCCTCGTCGCCGCGTGCCTCTTCTGTGTGCCTCCCGAGATGAATCGCCTCCCCAAGGACGAAGACTCTGCAGGTGAACACTCGCCGAGCGAACTTGGAA
GTGACCTCTTGAGCGTCAAGAACTCGCCAACGGAGAACGATTCTGACCTCCCAGCGAGTCCCATCGTCGCCTCCGAGAAGCAGGAGTCCGCCTACCGCAT
CTGGTGGGAGGTCCTGACCAACACGCCCTTCATGCTCATTGTCCTCGGGAACGGCGCCTACACCTTCACGCTTGGCGTGTTCAACACCTACGGCCCCGAC
ATCTTCCTCGGTCTCGAGCTGTTCGACAGCGAGACTTCGGCCTCGTTCGCGTTTGGCGGTATCGTCGCCATTATGAGCCTCATCGGTACACCGATTGGTG
GCATGGTACTCGACAAGGTCGCCAAGGAGGACGCAACTCCGGCCCGCCGCTGCTTCGTGGCGACAGTGTCTCTCGTTATCTACGTGGTGATCGCCGAGGT
GTTCGCGTTGGGCTTGTACGCGTTCGCGAGTGACAAGATTCCATTTCTGGCGTGCTTCGCGGTCGCGCTGTTCGGCATGTGCGCGCTGTGGGGTCCTCAG
ATGGTTGCGCTGCTGGAGCTGTTTCCCGAGACACGGCGCTCGATGGCGATCTCGGTGAACGCAGTGGTCGTGCACATCTTCGGCGACATCCCGGCTCCAA
CCATCATGGGCGTCGTGCGCGACGCGTGGGCTCCACTGTGTGGAACTGTCGAGATTGATGGCCACACCAAGCTCAACCCTGAGTGTTACAAGGACTTCAG
CGGACTGAAGAACTTCATGCTGCTCACCGTCCTGTGGCTGACGTGGGCCGTACTGCTCTGGAGTGTCGCCACGTTCGCCATCAAGCGGCATCAGAGGCTA
GGAAGGTTCCCGACACCAGCAGCGGCACCGAGCGACACCCAATCCGCATAGTGGAGACTCGGCGAATATACTCTCGAGCTGCAGTCCATCGTTCGCCGAT
CCTGGGGACTGCTGGTAGTTGAATTTGTGAGTTAGTAGACTGCTGTGTTGATACGGACTCGACGATTTGTACCCGCGAGATAATCGAATTCGCTGATCCC
TCGGACAGCATCACAACCGCGCCATGGTTTCTTTTTGTTTATACAATACAAACGGTTGCTGCTTGCGCGAGCAGGTTCGATCGAGGCGGTCTATTCGACG
GCGCGTAGCCACTTTCGCCTCGATCCACTCGCTCGTTTCCCTCTTCTCTTCCTCCCTACTCTCTCCTTCGCTTATTCCCACTCGATCGTGGCCGGCGGCT
TGGACGAAATGTCGTACACGACGCGGTTGACGCCACGCACCTCGTTGATGATGCGGTTCGACATGCGGCCGAGCACCTCGTACGGCATGTGGTACCAGTC
GGCCGTCATGTAGTCCGACGTGCTGACGGCACGGATGGCCACCACCTTCTCGTACGTGCGACCGTCGCCCATCACGCCCACCGACTTGACAGGCAGCAAC
ACGCAGAACGCCTGGCCAGTGGTCTTGTAGTGGCCCGACTTGCGCAGTTCATCGATGAAGATGGTGTCCGCCTGGCGAAGCGTGTCGAGCGCCTCG