Description :
From Genome Similarity Track
Location :
Scaffold_1468:104- 2182
Transcript NameFunction/comments
g16813.t1ETI33998.1 hypothetical protein F443_19400, partial [Phytophthora parasitica P1569
g16814.t1hypothetical protein

Sequence
2078 bases(100 bases per row)
CTCTCGCAATCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTACGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGCGGTGCATGTGCTGC
GCCGACAGGGCCATCGCTCTCTGTCGCGCTGATGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTTCTAGTCGATCACCGGATCAATGGCCGTGCAAAG
CCACGGCATGCCCAACCACCATAGTCGAACTTATCGTCCAGTTCGCAGGACGATAGCTCGTCCGAAACGAACTCCCTTCTCTTGAAATTAAGAGAAGGCG
TACGCGTACGATACGCTTCTCAGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTT
GGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGAATGACAAGGT
TCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACC
AGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCGGGCATAGTGACCGATG
TTTCCGCATCGGAAACAACGCACATTCGTTGATACACGACGCTGCTGGTTCCCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACG
GCCTTACCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACGCTTCTTGCATTGCAAGCGCAATTGCAGCCTC
GAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCATTGTCGCCTCGTCAATCGGGTTG
GTCACGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCTGCCCTCGATCGGAACT
CGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAACACCTCGTACGCGCTGAAGCACGTAGGGTCTGTGAGTCGGCGTTCGTACGCCCAACT
CCTTGCTCGTCCGTCAAGACATGACATGGCGAACGCAACCCTCGACAACAGGTCGACGATACGTCGAGCAGTAATGACAGTGTCGGCCTCGACAAGCCAA
CGGAAGAGAGGTTCCCCCTCTCTTCCAACATAGCTGCTTACGTGGAGTGTCAATGACTCCACGCGCGGTGTGGCCGAAGGCGACACCGAAGCTCGAGCAG
TGGTTTCACGCTGCTCCTTCACGATGAAACCCAGAACAACATCGTGTTGCTCCGTCGGTGATAGCGTACACAACATCGTTGCTACCGCTGCTTCTCCAAT
GACCGTCGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGATAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTTCAGACGTGTTTGGGCTACCCACG
AACATGTTACTGTCCGAGGGTGCGTTCTCAACCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGGCTACAAAGTGCTACCAGG
TGTAATGGGTCTGCTTAGACCCACTACTTTAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTATTTACCTTAGATCCAGTCTACTTGTATC
CACAAGTATACTTAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTGAATGGGGTTTCCTCCTAAAACTGATA
TTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCT
CTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG