Description :
From Genome Similarity Track
Location :
Scaffold_179:104- 1426
Sequence
1322 bases(100 bases per row)
CGCGTAGTCCGGCCGACGCGACAGCGCGTCGGCGAGGATGTTGGTCTTGCCAGGTTTGTAGTGCACAACAAAGTTGTACTCGGAGAAGAGTGAGAGCCAA
CGCGCCATACGCTGGGATAGGTGCGGGATCTTGGTTGCCGTTCGTAGCGAGGCGTGGTCGGTGTAGATGGCAAAGGTCTTCTCGCCCAACAGATACACGC
GGAACTTGATGAGTGCGTAGCGCATGGCTAGGAGCTCCTTATCGTGGACGGGGTAGTTGCGCTCCGCCGGCTTCAGTTGGCGCGACTGGTAACTGATAAC
ACGTTCACGCCCTTCGTCGTCGAACTGCATCAAGGCGCACCCAATAGCGTAGTCGCTTGCGTCGCAAACGACGTGGAACAGCTGCGAGTGGTCAGGGAGC
ATGAGTACGGGCGCGGTGGATAAGCTCGTCTTTACCGCGTCGAATGCCGCCTGGTGTTCAGGGCGCCATTTCCACGTGGCGTCCGCCTTGAGAGCTGCGA
GAGTGAATGAACGGTCTCAGCAAAGTTCTTCGTGTAGTGGTGGAGGTAGGTGGCGAGGCCGAGCCACTGCCGCAGCTGCTTCTGGTCCCGTGGAGCTGGT
CAATCACAAATGGGCGCAATCTTCTCTGAATCAGCACGGACCCCTTCCTTGCTGACATAGCTCCCGAGTACCGGGATCTCGGGAGCGCAGAAGATGCACT
TCTTCAAGTTTGCATACAACTTGTTCTCGCGCATGACTTCGAACACCTTGCGGAGATGCCGAAGGTGGACCTCAATGTCGGTCATGCCGTTCTCGGCATG
ACTGTGAATGAAGATGTCATCGAAGTAGCTGGGTGCGAAGTCACGATACGGGCGCAGTAGATTGGACACCATGCGGTTGAAGGTGGCCGGGGCGTTTTTG
AGCCCCTGCGGCATCAGGAGCCATTCCCAAAGCATGCCGCTGGAAGTGCTTACAGCAGTCAGCGGAACGTCATCTTCCCGCATCAGGATCTGATAGAAGC
CGTCAATCAGGTCAATCGCGCTGTAGGTGGTGCTACCCGACATGGTGTCGAGCACCATATCCTTGCTGGGAATCGGCGTCTGCGCCGGGATCGTGGCGTC
GTTGAGCTTGTTGAAAGCGTGGACTATTCTCCACCCGCCCGTTGCTTTCTTAACACAGAAGGTGTGGGTGGAATGGGGTGAAAGGCTTTGGCGAACGTGG
CCGGCTTGCCGGCGACTTTCGAAGAAGGCGTCAATTGCTTCAACTTGATCGCGGGGAAGAGGCCACTGTCGGGTCACGCAGTACTTCGATCCGGGCACGA
GGTCGATCTCATGTCGTACGCC