Description :
From Genome Similarity Track
Location :
Scaffold_1824:104- 1312
Sequence
1208 bases(100 bases per row)
TGGAGGACCCCCTCCACCTTCATGCCTTCGTGAAAAGtctggaaaaaaaaatggaCAGCCTCGCCGAATATATTATCGCAATTGCTGCACCGTGGAATCA
CAACGAACGACCGCAATTCAAGTTGAACAGTTCTGGTTTAGCAGAATTATGTACGAAGTGGGATAAATCCTCTGCTTCCTTCCTAAACCGGCAACGGTAC
CGACAGGTTCACAATTTTATTCAGAAGCGCattcgaagcagcagcaacgcaagATTATGTTCGGAATGGATGGCTAGGAACGCTACTCGATGGAAAAATA
ATCCCTGCGAAGACGATGCTAGCAAACACAAAATTCGACGTCGCAGCGGTTTGTTGGACACGGAAGCCGAAGGTAAACTTCCTGAGGGAGATGACTATAT
GTATTGGTTAACGAGAGCCGCTGCCTTAGGAAATCCTACGCATCGCGAAAGTGTAAAAGCACTACAGTCGTCGTATTTATCGTTAATGGGAGTGGAAAAC
AGCAATGGTGAAGTGAGCACGTGAGGCCCCACGGCCCAACCAGCAAGTGTTCAAGCTGTAGTGTATCATGGAAGTACTGAACAACTTCCCCTCCAGATTG
AATCGCCATCAAATCTCCAACTAATAAGTCGACAAATCCAGAAAATGCCATCAAGGTCTCAGCTTGTGAAACCAACCTCCTCTGAGAGAATTCCGAAGCA
CAGCGTTTGTGGTATTAGCGATCCATTGAACGGTGGTCTATCGGCTGCAACAGTGACTGACGTGGCTGCATCTCCCGAACAACAAGAGGTTATTGATTGG
ATATTGTCAAACTTGGACAAGTCCCCACCCGTACAGACACTTACGATGATGcacggaggagcaggaaccGGGAAATCTTTTGTAATTCATAGACTACGCG
ACGAACTGCTAAAACGCGGTCTCAAGACAGTAATAACGTGCCCAACCGGTGCTGCCGCGAGTCAATTTCCGGGAGGTCAAACTTGTCATGCTGCATTCAA
AGCTGGTCGCGAGGGTGACCATATCTCGGCAGCTAAGTTGGCGGAACTTCAATTAAATTGTGACAAGACAGTAGGACTTATCGTCACGGATGAAGTTTCG
ATGCTCGGGGGCGAATTTGCAGTGAAGATAGACAAGCGATTACGTTTGATGTACAATCCAGATCTACCTTTCGGCGGGAAGTCTATTTTCTGGGTACGTT
CTACCTCT