Description :
From Genome Similarity Track
Location :
Scaffold_346:104- 1279
Sequence
1175 bases(100 bases per row)
ttgatttatattatacttgtggactcaagtataattaattcaaattattaataaactcctacgcttcctcatacacgtagcgcgacgtgtaagctaaagt
agtgagccaaagtaggcccactacacctggttgcactttgtagtccgtccaacgaccgactacttgacgttcgtacgaggtgtacgaacgcggagacgag
aaccacatgggcacggaggtgcccatggagagctccaatacgcctgcaactcatgttgcacgggcggactgcccccacctgtcggatccagagtgggagg
ccctccaacgactgtcaacagtcattggggaggcggcgatagctacaatgttgcgtacgctatcgccgacagagcaacatggtgttgctctgggattcat
catgaaggagcagcgcgatgctgcttccccaacaacggcgtcgtcggggacgacaccgcgtgctcaatcattaaaattgagcgtgagcaattatgtagga
agagagggcgagcctctcctccgatggcttgtcgaagtcgacatagccattgcggcttgacgtatatgttgatccgttgtcaaaggttgcgttcgctatg
tcatgtcttggcggacgagcgaggagttgggcgtacggacgccgactctcagatcctacgtgctttagcacgtacgagatattcaaagaggagctcaaac
aagcgtttgagcccccgcaaaatgaattccggtcgaggacggaattcctcgacctgcagcagggtaagcatgacgtccatgcttacgcgcagcgtgcacg
gtacttggtctcgaacatcgtgaccaacccgatagacgaggcgattaaagtcgtcacgttcatgaagggactgagagatgggcctgtgaagacctatctc
ttccgagagtacccgagtactctcgaagctgcgattactctcgcaatgcaagaagagtttagcctgcggcaggctaaactacatgcgagcgtgccgaggt
cgcaaccgcgcccggtagtgagcacgggaggtccggaaccaatggacctctcgaatgcaacggctgctgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN