Description :
From Genome Similarity Track
Location :
Scaffold_142:103983- 105464
Sequence
1481 bases(100 bases per row)
ACGTCAGACAGTCGTACCTTGGCGACCTTTCCCATCACCCTTACACTGATAAGTGTATTACCACGCTTCATAATGTGCAATGTCACTGCATTATCCAACA
CGTCGAAATTGTTCACGAGATGGCGACTAGATCCACAGTCCAAAATTCACACACTTTCTTCAATGCTCGTGTTCTGAACCGCCAAAACAAAATCTACCCT
CTCCTCCTGATATGACTTCTTTGTATAGCAGGGCACTTCGCCATTACATTTTCAGCTTTTCCACACTTGTAGCACCTTTGAATGTCCAAATTCTAATGCT
GTACGTTCTTAAAGATGTCCCTGCTCACTTTGCCTCGCAAATCAAATCTTCTTCTACTGCGCAAAATGTGCCAGATCTTCAGCTTGCTGCAGGTAGTTGG
TGCACATGAGATTCAGCCTCTCCAGCATAGATACCCTCACATCCGGGTCAGAGTAATGCACAATATCATCCTGTACCAACTTACCGGCACCTCTACGCGC
CTTGCTCACTGCTACCAAGTAGAAGTAGTACTCGTCCATATTATCTTCGCACTCTTGGTCGCCGTTAATAATATCGTGTTTATGCAGGCGTAATCTCGGT
TTCAAATGTGTACAGCAGTCGCTGCATCACGTGCTCCAAGCTAGGATTCTCTTCTCACCATCCTTCCACCTGCCTGTTATAATAGCGCTCAGCTATTCCG
GACAAGATTTGGCCAAAGTTGTCAACCTTAACGTCCTCAGTCCACGGTAAACCACACCCTCTGTCGGCAAACTGGATCTGTTGGACAAATCTCTTACCCC
CGGATAGAAAATCTCTCCCTAGTCCTACAAATAACTTTTTATCTAGAAAGGGCAAATCCCCAGATTCTATTGACTAGTGTCCCGGCACGCGACCACACTG
TGGTACAGGCGCGAACTGCTGTAGTGCTGCTGGTTGATATACCTGCTGTGGCACAAAATGCTCCGGTAGCACCGGCTGCGGTGCCTGCTCCATCTCCACG
TTGGCTATATCTTCAGCATATCCACGCTTCCTTGCACCAAAATACGTAGATGGCGATGCTCCAGGCTACACGAGCCTCAGTGGCGTCACCTCCACCAACT
CCTCTGATCATGACCTTGCCTTACCCCAGCATCGAACCAAAATCACTAGCCTCATGGCCCTTCAAGCCCTCCTTCTCCTCATGTCGCCCTTGCGACACCT
CTATGCGCTCCGTGAGAAGATCCAGCATATTTATCTCTGTATTTTTCGGGTCTCCTTGACTTATTATCTCTATTCAGGTGCTCCAGCCCTTTCGTGCCCG
GTATCTGCCCTCAGCTGCTGACGAATTTCAGCCGCAGAAACCTCTTCACCATTTTTGCCCATAACCTGTTGAAGCGCGGGAATTTTGTAGAAAGTAGAAG
TGATTATATTAGTGCTACCTGGATATTTGGCGGTTTACTCTGAACGTCAGCCATACTAACCTAACCAATGCATATCCCAAG