Description :
From Genome Similarity Track
Location :
scaffold_64:103963- 106205
Sequence
2242 bases(100 bases per row)
CAAAACCAAGTGCAATGTGCTGCGGTCAATTTTTATAATGCTTGGAAAGAAGACGCAACGCATTGCTTAATAGTATACTTATCATAACCTTAACATCTTT
GGTCAGATACACTTGTGGGGGTGAAACAACGTTGTACACAATAGCCGCCACAAAATAATCTGCATCAATACAAGAAGGTTGATTGATAATGCACGGGTTA
CATGAGCCTGTTCCAGGCGTACCGTGAATGATCGGAAGCTAGAAGAAATAATATCTGCCCAACAGCTGAGAAAGTTCATCGCCGTACATAAATTATTCGT
GAAAGGCTTCCGAGTGGGTGCGGCTCGCACCGAGACCTTCCAAGATAATCTAGACTCTACTAAGGTTGTCGCATGAATTCAGGATACTACTTTTTTACCG
CGAGGCCGTTCGAAGTACGAAAGGTAAATTTATAGGTGCTACGTACTTATATCCTGATGGAGCTTTGATAATTTATGAACCCAATTCTGccaagaagcag
aagtgctCTTGGTGTGCGCGCACTTCCGGGGATTGTTTGGTGGTATTCTTAGGTGCCTCAAGCGGAGCTCGAAAGGCAACAGCTACAGTGAGCTGCGATC
TCAGGGTGCGGTGGAAAAGAATGGCTGTATGTCCCTATTTCCAGAAGGGGTGTAAGACAACGAGTGTGATCTGACGTTCTCTGATCAAGACCGGTGGATA
GAGATTATTGCGGTTCCCGTTCCAGAGCACGTGAATGAATATCAATAGCTGGAGGAATTATCCCTCGCGTCCATGTGCAAGGAATTGCATGACGGTGAAG
TTAAAAAAAAAGATGGTACGCATGGAACGGGGTAGGAGATGAACTGCTAATTTCTCATGGCTGGATCTGCCATTGAAGACTCTGATAGAGTATCGAGAGC
TATAAATGGGACAGCAACCCGCAAGGTTTGTTGGGTTTTCAATCATCTGCTAAATGAATATCACGACGTGTGGGTAAGAAATCCATCACGCGTGCTGCTC
CTGGAAGTGGTGTACGCCGTACAAATGACTTGATTCAAATACGGCAATGGGTCCTCACCAAAAGAGCAACGTGGTGTCATTTAAACTTCTGCCATGCGAT
GAATGAAGTGAATCTAGTGAAAACGAGTTTTCTTTTCACTCAGAGCCGATATTCGTTTTCTGAAAGGCTATGGCATATTATGCCGTTCTATAATAAGCGA
AATGCAGCCACAATTCCGGCGCATACGCcgatttttgaaaaaaaaaggCTGCAGAATAGCAAAGTCAAGTGTACTTTGTTCTGTGCCCTTGACCTGGCCA
ATAATTTTTATCAATAGCCGTTTAAAGGTAGCAGTCTCTCTCTCACTACGGTGTAAGATTCTTGCGGGATGCGCTAGAATTTGTGGGCTATACTACAAGG
ACTGCCAAATGCAGCATCAACGTttcgccttgcgcagcagcTGCTCAAACATATGGTGGCTTTGCATATACCCATCTCGGCGTTAGATTGTTCCAAAGCC
TTATAGTGCTTGGTGAGTTGGATACATCTAAACACTTGCATAATGTTCAAGTTCATGCGCTTAAATTAGCAGTTTTACCAGTGTACACATGTCTTTCTTT
GGCGTCGATGTATATTCTAGCTCTGAGTGTCTTACTGGGACGCATGGTCTGCGAGCACAGAACCCAAAAGGCAAAGGCCTTGGTTGATTTGCCAGTGCCT
CTACCCCAAAAGAACTTCAGAAAGTGGTTTGGTCtgaccaactacttgcaaaaaTACGGCACGAACCCCGACATGGCACCAACCCTCATTAATATTTCTT
CCTGAATATATGTCAAATTATGTTGGGCGCGGCAAAAGAGGCGGTATCCAAGGCTGTGGAACAGGCCTCAATTCTGGCCCTTATCCAGATCGGACATTCT
ATGTCGGTTGTGACGCTTTAGCCTTCGCGATAGGGTGCAAGCTGATGAAATGAACTTCGATAGCATTAAGTTTCGCCAACTTAGAACAGCAGAGAAAAAG
TTTCTTGTTTCTTACAAGGCATTCCTTGCAATAAAGTATGCCCTCGGCAGGTTCAGAGTGGACCAGCTTGTCttgaagccgtttgtgatctgtacaaatc
atgcgtcattgcgCATAGCGACGTTGCCACCTTATCGCTTGCAGACGGTGGCAAAAGTGCTAACCCCTCTTTGTCGAGTATGGCTTTGAAGTACGGTGTA
AGCCAGGCGACTCAGTGTGGTTGGGTATGCGCTTTTGCGCCT