Description :
From Genome Similarity Track
Location :
contig_60:103937- 105934
Transcript NameFunction/comments
g10680.t1XP_024579699.1 eukaryotic initiation factor 4e [Plasmopara halstedii
g10681.t1hypothetical protein
g10682.t1RAW43650.1 hypothetical protein PC110_g186 [Phytophthora cactorum

Sequence
1997 bases(100 bases per row)
TTATGCTGTCTACGCTGACCAAGGACGCGTTCAGCTCTGGGTGGCACTTCGTCAACAAGAACGCGGAGAAGCTACAACCGACCAAGTTTCAGACGAACGA
GCTGAAAGAGATCGTGTGGAACCATTCGATCGGCATTATTGACGATACACTTGGCCAGAACGCGAACCACCCTTGAATAACGTTCGTGCTCAGGTGGATG
GAGCGCTCGCTAGTGACCAATATTTTCCACGACAACAACGTCATTTCGTTTAGTCCTATGCAAAACCAAAGTGCCATCTACTTTTTAGCGAAGAAGTTCA
GACGAAATGAAGAATACTGTTTGAAAGCACACGATGACCTTTCACACTCCGGAAGATCTTTCAGGGCGTCCCTTTACTCTCAACGCAAAATGGCGCACGT
TAAGCACGCTCTCGTTGTTGGCGCTTCATCCGGCATCGGTCGTGCGGTGGCACATGAAGTGGCACCACTTGTGACGACGCTAACGCTAGCATCTCGCTCT
TGCCCGCCCGACTTGATCTCTTCCGTCAAGGAGAGGAATCCAGACGTAAAAGTGACCCACGTGAAGCTCGACGTGTCAAACCTGCACGAAGTTCGACAAT
TCACGAGCAAGCACAAGGAGGCCTCTTTCGACTGGATCATTATGTCACCGGGCATTCTGTCTTTTAGTGGACGTATCGAAACCTCTGAAGGCCTCGACAT
CAAGATGGCGACCCACTACTACGGACGGTAAGCTGAGCGGCCGAGGCTGTCCGTGAGGGTGAGACTAACTGACTCCAATATTGTTCGTAGCTTTATGATC
GTCAACGACCTGCTTCCAACACTTAACCGCACTGGGGTGCGCGTGCTGAATATTCTGGCGGCAGCAACCGGAGGCAAACCCGATGTCAACGACTTGGGTC
TCAAGAAGACGTTCACCATCAAGCGCTGCGCCGACTTCACCACTACCTACTCGTACGTTGAAAACCTTGTCTTCCTCACTGAGGCTGTCAGTGAATAACC
GTCAATGCTGCTACAATAGGGACCTGATGGCCCAGGCCTTCTCGGAGAAGGCACCTCTTGCCAGTTTCATGCACGCGACACCCGGCGTGGTCGCGACTTC
CCTTGCTAACAACTTGCCCTGGTACGCGCGTCTTCCAGCAAAGGCGATCTCAGCGCTGATCGCGCGGTCGCCGGAAGAATGCGCCAAGTCCATGATGCTA
GCGTTGACCAAGGACGAGTTCAGCTCAAGTTGGCACCTGGTCAGCAAGGACGGACAAGCCCTGCAACCGACCAAATTCCAGACGGAGGATATGAAGGAGA
TCGTGTGGAACCACTCGGTGAGCACGATTGAGAACGTGCTTGAGCAGGTATAATAGACTACAACAACATGTAGGGACCATGAGTCGAAGCTGAAAGTGCC
GTCCGACAATCTTGGGTTACGTTAGGAAGTTTGTAGCAAGACTACGAGTCTTCTGCATGTGCACCTCATTGTCAACCGTTGACAGGAGTTCCAAACCTTC
GCAATTATTTGCTGTTCGAGCTGATGGGACCGTTGGAAGAGCCTCGCAGTACGGGCCGCACAACGCTGCGTTAGCAATGCCTCTATGCACCGCATCTGGG
ACCAGCAAATTGACCATCGTGCATTTTACTCCCCAACGCCCGAGACTCATTTCTGCTTCTCCACCCACAGGGCCAAGCTTCCTAGCAGCTTGAGATGATG
CGTTCTGCGTCGGGGTTGTTGGTGCTCACGCTGGCTGCTGCAGCCCGCTGCGCTACGGCCGGATCGGGCTTCAGCGGGTCCTACGATCCCTCTCACACCG
TTAACATTGCGACCGTCACCTCTACCTCGGTCGTTCAAGACAACTCGTCATCACTGGCGGCAATGTTCCCCATTGAAGGAGAGGCGATTGACATCGCACT
GCTGGCCAACAGTACAATCCCAGACACGTGGCTGGAAGCTGTCGCTGGCTATGCCGCTGCTGCGGATAGCAGAGTTCTGTACCAGACAGCAAGCTGG