Description :
From Genome Similarity Track
Location :
contig_60:103927- 105924
Transcript NameFunction/comments
g11152.t1hypothetical protein
g11153.t1hypothetical protein

Sequence
1997 bases(100 bases per row)
TGTGCGAAGTTTATGCTGTCTACGCTGACCAAGGACGCGTTTAGCTCTGGGTGGCACTTCGTCAACAAGAACGCGGAGAAGCTACAACCGACCAAGTTTC
AGACGAACGAGCTGAAAGAGATCGTGTGGAACCATTCGATCGGCATTATTGACGATACACTTGGCCAGAACGCGAACCACCCTTGAATAACGTTCGTGCT
CAGGTGGATGGAGCGCTCGCTAGTGACCAATATTTTCCACGACAACAACGTCATTTCGTTTAGTCCTATGCAAAACCAAAGTGCCATCTACTTTTTAGCG
AAGAAGTTCAGACGAAATGAAGAATACTGTTTGAAAGCACACGATGACCTTTCACACTCCGGAAGATCTTTCAGGGCGTCCCTTTACTCTCAACGCAAAA
TGGCGCACGTTAAGCACGCTCTCGTTGTTGGCGCTTCATCCGGCATCGGTCGTGCGGTGGCACATGAGGTGGCACCACTTGTGACGACGCTAACGCTAGC
ATCTCGCTCTTGCCCGCCCGACTTGATCTCTTCCGTCAAGGAGAGGAATCCAGACGTAAAAGTGACCCACGTGAAGCTCGACGTGTCAAACCTGCACGAA
GTTCGACAATTCACGAGCAAGCACAAGGAGGCCTCTTTCGACTGGATCATTATGTCACCGGGCATTCTGTCTTTTAGTGGACGTATCGAAACCTCTGAAG
GCCTCGACATCAAGATGGCGACCCACTACTACGGACGGTAAGCTGAGCGGCCGAGGCTGTCCGTGAGGGTGAGACTAACTGACTCCAATATTGTTCGTAG
CTTTATGATCGTCAACGACCTGCTTCCAACACTTAACCGCACTGGGGTGCGCGTGCTGAATATTCTGGCGGCAGCAACCGGAGGCAAACCCGATGTCAAC
GACTTGGGTCTCAAGAAGACGTTCACCATCAAGCGCTGCGCCGACTTCACCACTACCTACTCGTACGTTGAAAACCTTGTCTTCCTCAGTGAGACTGTCA
GTGAATAACCGTCAATGCTGCTACAATAGGGACCTGATGGCCCAGGCCTTCTCGGAGAAGGCACCTCTTGCCAGTTTCATGCACGCGACACCCGGCGTGG
TCGCGACTTCCCTTGCTAACAACTTGCCCTGGTACGCGCGTCTTCCAGCAAAGGCAATCTCAGCGCTGATCGCGCGGTCGCCGGAAGAATGCGCCAAGTC
CATGGTGCTAGCGTTGACCAAGGACGAGTTCAGCTCAAGTTGGCACCTGGTCAGCAAGGACGGACAAGCCCTGCAACCGACCAAATTCCAGACGGAGGAT
ATGAAGGAGATCGTGTGGAACCACTCGGTGAGCACGATTGAGAACGTGCTTGAGCAGGTATAATAGACTACAACAACATGTAGGGACCATGAGTCGAAGC
TGAAAGTGCCGTCCGACAATCTTGGGTTACGTTAGGAAGTTTGTAGCAAGACTACGAGTCTTCTGCATGTGCACCTCATTGTCAACCGTTGACAGGAGTT
CCAAACCTTCGCAATTATTTGCTGTTCGAGCTGATGGGACCGTTGGAAGAGCCTCGCAGTACGGGCCGCACAACGCTGCGTTAGCAATGCCTCTATGCAC
CGCATCTGGGACCAGCAAATTGACCATCGTGCATTTTACTCCCCAACGCCCGAGACTCATTTCTGCTTCTCCACCCACAGGGCCAAGCTTCCTAGCAGCT
TGAGATGATGCGTTCTGCGTCGGGGTTGTTGGTGCTCACGCTGGCTGCTGCAGCCCGCTGCGCTACGGCCGGATCGGGCTTCAGCGGGTCCTACGATCCC
TCTCACACCGTTAACATTGCGACCGTCACCTCTACCTCGGTCGTTCAAGACAACTCGTCATCACTGGCGGCAATGTTCCCCATTGAAGGAGAGGCGATTG
ACATCGCACTGCTGGCCAACAGTACAATCCCAGACACGTGGCTGGAAGCTGTCGCTGGCTATGCCGCTGCTGCGGATAGCAGAGTTCTGTACCAGAC