Description :
From Genome Similarity Track
Location :
Scaffold_146:103916- 109323
Sequence
5407 bases(100 bases per row)
CGAAAGATTGTGAAAAACGCGCTGTAGGGACAAGAATAAGCTTCGTCGGGCAAAGCCAATTTATACTTTATCGATCTGTATTTTTGACAAACAACACTTC
ATAATTAATAGATATTGTTCTTTCCGACAATTCTAACCAAATATGCAAGTGTTGCTGAGTCATATTTGGGTAAGGTATATTAAAAATCTAAACCGATAGA
TCTCTAGTGTTGTGCCCTAAGAACACGCGAGTAAAATATTTCGTGAAAATCTCTTAAACTCTAGAAGGAGTAGGAACTCTACGAATGTACCACTCCATGG
TACACCCTTTTTGTATAATTTAAGCCGCAATGGTGCAATATGCTACTGCAATCTGAATTTTGCAATTTAACTACGTTAAATTTAGCCAAATCACAACCTG
ACCTCCGGGCTGAAGTCTACTGTATTTATTTTAAGGCAACACTTAAAATAGAAATAGACTGCGAACTACATTTTCAGCGCTTCGGCAAGCCCCATTCTGC
TTTGTGCGCAATGCCACGCCTTAACCCACGACAGCGCCACGCCCGGAACATCCAGCGCCGCCTGGACGGCTCGTTTTACCGTCTCCGACTGAATCCCGGT
ATTTCCGCTCATGACGTCAGCGACGAAGACACCGACGAGCAGGAAGAGGAAGAATCATCAGTCGGGGGTGGACTCCGAGAAGAACGACGTAGGGGTGGTG
GCCTCTTCGCAAGCAATCGAAGGGCCCAGAGAGGCGTGGATCAGTGAGGTAGAGCGAATATACGCGAAAAGGTGGATCAACGTAAGAGTATATTATCTCA
TCCAATGGGTTGGGTACCGGGAGCTTACATGGGAACCGGGAAGCCACGTTCCGATGCGCCTGAAGCTACGATTCGAACGCGAATCGATCGACTTCATCTG
GGTCTACCAATCGACAAGAGGGAGACGTCGGACTCACCATCGACGACCGACACGACGCAGCGCAAGGATCCAGTCTCGCAGAGAGTANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTAAAGCTGCGCAACAAAATCGTCACCTGCCTAGGATTTCAATAAATTGGACGTGGCCCCAA
TGTCGAGGGCGGGATCAAACATCCAGCGACGACGCTTGCTCGTAGTCTCCGGAAACTTTGGAGAATTGTTCACCGCGCCCACAAGTTCAGAACCAGGGCC
GAGTAGCTAACGTTAAATTTATTTTGGATATTACCTGAACGCGGGTTCACACACCATTCGACTTCCGCCGGAGCCGGATCTCTGCGTAACTGACACACAT
ACAACTTGTACGTTGCGTAGTTGTCCTCTTTCCAGCATTGGGCAGATAGATAGCAAGATGTTTGGAGCTTTCTCGACGTATCGTGAGACCAACGCAACCG
CGAGTCGATCCATGTCCTTTTCGATAAGAACTTTGCTATGAGGTCTTCTGCCGTTTCGACCGCAATAGTTTCTGCTAGAGCAGAGGCATTTTCGGTTGAA
GCGTATTCAGATCGGACGCTGCATCTGGTGTTTGATCCAACTTATCGAAGCTCTAGAGGGGAAAGCTTGCCATCGTTCGAGCCATTTGTGTTATTAATAA
CTCATTGGCGAGAGTACTGCAAGGAAATAACACAGGGAAACGTAAATTATCGTAAATTATCATGGGGTGATGAAGAAAGAAGGGAGCGATGAAGTGGCGG
AAACACGGACGATTGAAGCGGGCGCAGTGTAATGTATGGGTGAGCCATGGAGCCATGTTACGAGAAGAGTGGACCGGTATCAGAGGCAAAAGTGCTGGAA
GCCAAAGAATGGTTTTAGTTTACGACAGGAGCATTGATTGATGAAGGTGGTCACTCCACCAAACTTTCCAGGCCTGAGAAGGCAATGGTATCTGCAGTAG
AGCTCGAGGAGAATAGAACGATAATATCTTGTTGTCTGTATTGACGTTGTAGCCGCCACTAAAGCCTCCTTCATCAGCGTTAAGGCGTACGAACTCGTAT
TTGCACCCTCTGGAGGCTGCCCCGTCGGACGCCAAAGACCTGACTCACCATAACTTTCTCGATCTCCGCCTGACGGGCCTGCTCTTCCTGGCGAGCGGCT
TATTCCGCAGCGGCAGCAGCCTTGGCAGCTTTAGTTTCAGCAGCAACCCGAGCGTCTTCTTCTCCCCTTCCTTCTGCTCTTCTTGGTCGACACGAGACTC
GGAGGATGCTGACGCGACTGGTCTTGGTGGTCTCTGGCCTCCTCTAAATCGATGAAAATACTTGGAGTGGCGGGATGAACCAGGCTGGAGTCATTCGGGT
ATAGCTCCATAACCAAAACCAGCTCCAGCGTAGTTGTGTACGTGGACAGCCGTGAAGTGATTCCCACCCGCCGCCGCAGCAGCAGGGGCCCCATCAACCA
TCCGCGATGCCTGCTGGGCCTCCTGCATCGCAGCCGCGTAGGCAGCCCGACCGGTGTGGGCTGCCATGATTCGGTCATTCCGCGCGAAAATATATGCCCT
GCGTAGACTGCCTTCTTCCCTTCTTCTTCTTCCGCACGCGGCCAGCGTCCTTTGTCGCTGGGTTTGAGCGCTTCCGCTTCTCGCACAAATCGTGACCACA
CCCAGCCAACCAGGCTACCCCCAGAAGATCGAGCTCGTACGCATCAACTCCCCCGAAGAAAACCTCTAAGACCGCCACAACGCAAATTCAGAACTGAGGC
TTGGAGGCTTGAGAGAACTCACTCTGCTTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNN