Description :
From Genome Similarity Track
Location :
Scaffold_839:1039- 13102
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_839-abinit-gene-0.15Anoctamin
Pytul_var.sporangiiferummaker-pug3_contig_839-snap-gene-0.6Expression site-associated gene 8 (ESAG8) protein
Pytul_var.sporangiiferummaker-pug3_contig_839-snap-gene-0.11Glutamate synthase
Pytul_var.sporangiiferummaker-pug3_contig_839-fgenesh-gene-0.2Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_839-snap-gene-0.12Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_839-snap-gene-0.13Gene of unknown function

Sequence
12063 bases(100 bases per row)
GCTCCGGCGGTAACGAGCGTACGAAACTGGGTGTGCCCGAGAGAGACGTGCTCCATTGTAGGTCGCCTTCGAGTGCGCTGCTGTGATGACTACTGCGTCG
TCGTCGTCGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGACGACAAACGGGAGCCCGACCTCCTTGAAGTTATCGAGAAGCTGCATGCCAA
CCATGAGGATCCAGAGCCGCTCGCGCACGCGCTCGAGGTTTTGCACGTAAAACGCGAGGAACCAAAGCGACGCGTTACTATTGACGAAGTGGAACGGCAT
GCGCTTGAGCACAAGATTGTCCTCAAACTCCTCGGCCGTGCGGTAATTTTCAAACTCGTTGAGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
CACGCAAGTTGCTGGTACAGCAGATCCATGACGTAGATGATCAGCGCGTTCAACACGCCCGGTCCGTGCGAGATGAACNNNNNNNNNNNNNNNNATTGTG
GTGGTGCGCGTTGCTGTGTTTGATGTAGCAGACGCGGTAGCGCGATCGGAGATGGTCGGAGAGCATGTTGAGCGCCACTACGTAGCCGCCGACGACGCAG
CACATGGAGAGCAGCAGAGGGATCGCGAGCGACTGGCGAAACAACCGTTTGTGCCGCGGGAAATCGTAAATGTACTCGCGCGTAACGGGGTCATTTGTCC
ATTCGCCTTTGAACTCGGGCCGCGTCTCGATGTAGTCGAGTCCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGTACGCTACTGCTCGAA
GCCCCGCTCGGTTCCGTGAGCGCCTGGTATTTCCACGTGTACTCGACTTCGCGCTGCTTGCGCCGCCAGAGATCCACAAACACGGACGTGCCAATCGCGA
GCAAGAACGACAGCAAGCTGTAACTCTGTGCATTGAACTGGCCGAGCACGTACAGACACACGCCGCAGAGACTTGGGACGATCAGCATCTTGGTGTAGAA
GTCAAGCCACGCAAAGTACATCGCGATCTTTGGTCCGTAGTACTGGTAAATGTCGTACAGCGGTGGCGCGTACGTCGCGTGCTTGGTCCATTTCTTGATC
ATCGCGTCTCGGAAATCGTCGCGATGCAGCGGGTACAACTGAATCGTGAGGTCATCGCGTCGCGCGAGTTGGGTCAACAATTTCGTCTCGGCTTCAAACA
CGAGCACGCCGTTCGCCATGTACAGATTGTGATCCGTGCGGCACTCCTTCAGGATGAGCTTCGTGAGCTGCTGGGTTTGCGCATAGCCTGTCAGCGGCAA
GATGTGCTTCGTGTACGCCGGATGTAGCGTCACCCATGACGGAAGCTTCTGGTGATGACGAGGCAGCACATGCAGCAGAGATGGCTGCAGTGGGTTTGAG
GGCGGTGGAGGAGCCTCTTGATCTTCTGAGATCGCTGTATTTGCACTGGAGTCACTCGACTTTTCGTACCCAACAGTCATGACGTAAGCCTGCGCTGGCT
GCTTGGACTCGGGCAGTGCTTCTGAGTCGGCGTGCTGCAGTGGATACAGGATGACCTGGCACCCTGCGTCTCGAAGGATAATCGCGGTGATGTCGATGAT
TGTGTGTACATCCGATTCGTCTTTGCCGCTCGACGACGACGATGACGACGTTCTCTGCCGTGAAAACCGTTTTTCCTGATCGTCTACGGGCATGTCNNNN
NNNNNNNNNNNNNNNNCGAACACTCACTGTCGGCGATCGCGTCGCGCTGCGGGATCTCAAAGTACAGGCAGAAGTCGGCTTCGCATGCGACGTCGTGCTT
TTTCAGGAACCGTTGGAGGAAAATCCGCGATACTCGACGCCGAATGGAGTGCGCTGTGTCGTCGTCCTCGTCACTCGAGTCATCGTCGTCCGTGAGCTGC
TCATGTCGCTTCTTGAGATGGTCCATGAGTGGCGCACGTCCCGTGGAGTTCAGGATACGCTGCAGAATCGGTACGCGGCGCGCGGCGCTTGGTATTTTCA
CGCGCGGACCAGGGAGCGTGTGGTCATCGTCGTCGTATNNNNNNNNNNNNNNNGTCGCTCACTGTGCCACGGCTACGACTACGACTGCGCCTCTTGCTGT
CACTGGTCTGGGCCTCGTGGTCCGAGCCGAGCCGCCGCCGTCGTCTGGGCGCATCGCTGTCCCCGCGAAGCCGCCTGGCGAGGCTCTCGGACGCGTGCGT
GCTCTCCTCCTGCCGCGCCACCATCGCCAAGCGAGGGAAGAATTGCCGGAATGCTGGAATGCTGCGCTGGTGATACGCAGCAACAGGGGTACGCGTTTCG
TGGCTGATATGGTTACTACGGTTACGGTTTCGCACCCACCTGAATAGAAGGCTGTCATACCCACTAATTAATTGGAAGGGACGTCACTGTAGCTGGAATG
TTGCGAGAAGGTAAAAGTTGATGTGAGTGAGTGTTGGTCGCTATTCAGTGACTGCATCAAATCAGACGCGAGTGACTGACTGCCATGCAACTCAAAATGC
AACCAGCTCACCTTGATGTCGTCGAGTTTGAAGTTAATCTATCTCTACGTTGAGTATAAGCACAATGGGATTGCGTATGTATATCTGTCACTTGCCGCTT
CATATGAGCTGCACTATTAGCGTCATGATGTGTCGCTGGGTTGTTTCAGATAGTTCGCATCAACGTACCTGCTCAAACCAGATGGGTACGACGGAAGAGC
CGAATGCAGCATTGTCGATTCTGTCAGAACGGCTAGTTTCCTAATCCTGGTGTGAACAGCAGCTTCGGTGGGACACGGTTTGCGACTATGCCATAGAGAG
CAGCCATCTGGACGCTAGTAGTATCTGGCACGATGGGCAGGCTGGTAGGTAGGTTGCTGAAGTCTCTTATACCCGTAAATCCACAGTGGCGTTGTTGCGG
ATACTTTGCCAAACGTTATCACTCAAAAAGCCACAGGGTGGAGTGCACACGATCTCAAGACGCGACAGCATTGACAAAGCTATCATGAACACCAATCACC
TGCAAGATGTCTTCCCAATGGAGCTGTGGAACGCCGTCCTCATCGACTTCTTGACGCTCAACGAAGCCGTGGCGTTGGCCGAACTGAATCGCTTCTTTTA
CAAACTTGTGCACACTCAAGTCGATTTGCGAATGGAAGCACTTCTCGTGACAAGCGTGCGTGAATTGGTGCGCGTGCAAACATTGTGGTCGAACCTGAAG
AACGTGTCCTTCCAGCCTCTTCCCGAGAAGATGATGAAACGTGCCGCAGGCGAGAACATCCACAACAACGTGCACAACCCAGGTCTATTAACAATTGAAC
ATGGCGATGATGATGATGAAGATGAGGCAGTGATGATTGCTCATGAAGACGGCCACTCGACCTCAAGTCACGGCTACGTCTGCTCGCCAGAACTGGAGTC
TGCGATCCGAGAGAGACGCATTCAAAATCTCAATCTCTCTGGGTTCACTCGCGTGCACTTATTCGACGGCATCAACCGGCTCCAGACTCTTGATCTCAAT
GGCTGCGTTCGCATTGACGGACTTCACTTTCTCAATGGGATCTCTCACGTTGATCTGAGTTATTGCAGCAACCTCGTCGACATCTCGTTCCTCTCGAACA
CGAAAAGCGTGGATCTCTCATACTGCCACGAGATCTCAAGCCTTGGGCCACTTCGGCACTGTGAATCCGTGCAACTCAACGTTTGCCGAGGGCTCACGGA
CGTACATGCTCTCGCAAATGTCCGGCAAGTCAGTCTGCGCAATTGCCCTCAGCTTCGAAATGTGTCTGCACTGAAGAACGTGTACGATCTGAACCTTGGC
GGATGCATTGATCTCCGAGATGTTCGCAGCCTCGGGAATGTGCACACGCTGTGTCTCTCCGGATGCATCAATATCACAGACGTCAGCGCCTTGGGCTCAG
TCCACATGCTGAAGCTTCGGAAGTGCCTGGGTGTCACGAACGTGAGCGCACTTGGTGGAGTTTATGATCTTGATCTCAGCGGATGCATCAACGTCCGTGA
CGTCTCGGCTCTTGGCAGTGTCCACACGCTCGATTTATCACTGTGCAAGGAAATCACGGACGTTTCAGCATTAACTGGTGTGACGATTTTATCGCTTCGT
CAGTGTGATGGAGTCAACGATATCTCAATGCTCGGGCGTTCCCAGGGAAAGAGTACGCTACAAGAGCTTGACGTGTCGAGCTGCAGCAAAATCACCGATG
TGAGCCATTTAGGCAACTTGAAGAGATTAGTTCTCAGTCGCTGTCAAAGTATTACAGATTTGCACGGGGTCAAGAACGTGCACGAGCTGGACATCAGTTT
CTGTAAAAACATTCGTGACCTCGGCACCTTGAGTGGGGTTACCGTACTCAACGCGTACCGCTGTGTGGGTCTACGTGGGATTTCATCGCTGACCTCAGTC
GAGAGAATCAACTTGTCTGGTTGCGCTCTGATTACAGACATTGCATCGCTCGCTGGCGCTCGGGAAGTGGATCTTCGTTTCTGCGACAGCATTGAAGACG
TAAGCGCATTGGGCCGTGTGCGCATCCTGAAGCTCGCTGGATGCCCTCACTTGAAGGACATCTCTGGCCTCACGAATGTGTACATGCTTGACTTGAGCTA
CTGCCACCAAGTCGAAGACGTATCGGCTCTCGGCAATGTCCACACGCTTTCACTGAAGCACTGCAAACAAGTTCGTGACGTGTCCGCGCTAGGACAAGTC
CACTCGCTCAATTTGTCCGGTTGTGAGAGCATCGAAGACGTCTCTGCGCTCTCAAGGGTGCATGTCCTCAACCTCAGCGACTGTAAGCGTCTTCGTGACG
TGTCCATGCTCAAAGGTGTTCGCATTCTTGACCTGCGCTTCAACGCTCGGTGCTCTGACAAAGCGGACACAGTCGAGAAGCACCAACTGCAGGGAGTCGA
TGAGCTGCAACAGTTCGTGCCGATCATCAAATTGTAAATAACCAGAAGAAGTGCCATCTGATCTTCGTCACCGATATCATCAGAGAACAAGCACCGCCTT
CCCAATTTTGCTGCATGTTTTTCACTGCACACGTTGTTAGAAGCAAGTTTGATATTTAGGTAAAGATGTACTGGTCCTCAGTCACCTTTTGCGGCAGTGG
GGTAGGAAGTTTTGCTCGCCTGTATTCTTCAGTTTGCCATGTTTCTCAATTAATGCATTCGCATTTCCCCCCAATAAAACATTTATGAAATATCACCTTT
TCAAGGCCGCTCCTTGGCTGTTCTAGCACTACACACACCATCCTCTTGTCGAACTTGCTACGATCACTATCCATCTAACCATAGCGCTGGTTTTGGGACA
CTTCTGGCTGAAAGCCTTCGGTCAAGAAGTATTTCTCAACGGCATCGGCAACGCCTCGGCCTTCATTGATCGCCCACACGACGAGGGATTGGCCGCGTCT
GCAATCGCCCGCAGCAAAAACACCCTCCTGAGAAGTCTGGTAGTTACCGTACGTAGCACGAATGTTTTTGCGCTGGTCAACCTCCAAGCCCAACTGGTTG
GCAAGTGTCTGTTCTGGGTTCAAAAAACCCATAGAAAGCAAGACCAGGTCGCACGGCAGCTTCTCTTCGGTGCCTTCCACAGGGTAAAACATACCGGTAT
CTGGGTCGCGTTGAGACATCTGCGTCACCACATGCGTGATTTCGCCCTTGTCGTTACCCTTGAATTCCTTCGTGAACTTGCTGTACTTTCGAGGATCGTG
GCCGAACACCGCACGCACTTCCGCGTGACCATAATCGACACCATAGATACGAGGGTACTCTGGCCATGGGTTCGCTGCTGAACGCGACGCTGGAGGCTGA
GGGTTCAATTCAAGGTTCGTCACAGACTTGCAGCGGTGACGCATGGACGTGGCAACTGCAAAGCACAAACGAAAGTTAGTACAACTAGTCATTAATGCTA
AATAACACAAATCAAGTGGTACTTACTGCAATCCGTGCCGGTATCACCACCACCGATAACGACAACATCCTTGCCTTCAGCAGTAATGAAGTTGCGGTCC
CAGCCACTTTGCAGCTTGCCGTCGACAGTCAGCATCAATCGCTTCTGATTCTTTGTCAAAAACTCCATCGCGAAGTGGATGCCTTTCAGATCACGCCCTG
GAATGTCCATGTCACGAGGAACCGTCGAGCCGAGACACAATACGACCGCATCGTTTTCACTTTGCAGTTCTTCCATTGGAATGGTCTTGCCAATTTCAGC
ATTTGTCACAAACTCGATGCCTTCTTCACGCAACAAGTCGACTCTTCGGTTCACCGTCTTCTTCTCCAACTTCATGTTTGGAATACCGTACATGAGCAGA
CCACCAATGCGGTCTTCGCGCTCGTACACAGTCACGTGGTAACCTTTTTGGTTCAATTGATCAGCAGCGGCAAGACCAGCGGGACCAGAACCAACGATGG
CGACTCGAAGACCATTGCGGCGAGGAATGCGTGGCACGATCCAGCCTTCTTCGAACGCGCGGTCGACGATAGCGTACTCGTTGTTCTTGATCGTGATCGG
ATCATCGACAAGACCCGCAACACAGCCACTTTCACACGGCGCAGGGCACACGCGTCCCGTGAATTCCGGAAAGTTGTTGGTCTTGTGCAATCGGTCAATG
GCTTCTTTCCATTCGTCACGGAAGACCAACTCGTTCCATTCCGGGATCAAGTTGTTCACAGGACAGCCCGTGTTCGTCTGGCAGAACGGCGTTCCACAGT
CCATGCAACGCGCGGCTTGGATCTTGCGCTCCACCGGTTCGCGGGTATCGGTATTGATCTCATTCCAGTCGTGCAATCGCTCCGACGTTGGGCGGTACGG
GTCCGGCTGGCGCTTGAACTCAATGAACGCGCGTTCGCTGACGATATTGCCGATCGAGCCATCGCGTTTCTCAAAGAGCTCTTCCTGCTCGTTCGTGTTC
ACGGCGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGACGGGAAACGTTTGTACGAAGTGTCGACTGCATGATCAA
TTACTAAAACGGATCTTTTTTCTCTCTTTGAAGCAACTACAATGAGTGGGGTTGTATCTTCAACAACAGCACCAACGCGAGCTTCAACGACGCACGAGAC
GCACGGTAAGCGGAGAAAGTAGCTAACACGAGTGTTGGTCTAAGGAACGAACGCGCACACACCGGACAGTGATGCGGGGCGCGGCTCCTTCTTTTTCTTG
GCGTGGGCGGGGGCGGGGGCGAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATGTGGGCGTGCGCATTT
CCGCAGGTTCGAAACTTCAGATGAATCGTGCAATTCAAATCGAAAATTGCAATTCATTTCCAATTCATTGTCAATTCATGCATTGATGAATTGCGGGACA
TCTGGCAGCTGAGATTGATGATGGACCGCCTATGCACGCATAGATGATAGGATTATAGAGGTTGTTGGTTTAAAAACCGATGCGGGGATGGGTGCACCAT
CGGAAACCGGAGAACCCACAGCCATGCGGCTCATATCGAGCCGAAAACGATGCATTCTCAATGAGGCAGACGCGATGGTAGGTTCTGCAGGTCCATTTAC
ACCATAAACGAAGCATACCCATACATAACTATCCTGTTAAGCATATATGTTTGGCTCATTAGAGGCGCAATACTCGGTAGGACCTTCTGCAACACGTACC
CCAAGCACCAGAAGAAAATGCTTTACACTGCTACATCGGTATATCACTTTAGAAAGTATTATCCAATAATAGAGGTTTGGCTAGCGAGATGGGGGCGCTA
GAGTTTGTACAAACGCGACAGGAGTGATGGTCGATAACCCATCTCCCCAGTGAAAAGCTCCTCACTCGTCACAGAAGATCCGCAAAGCCCAAGAACCCAA
ATTTGCGTTACAAGAAAGTTGCTAAATACTTGCAAGATTCGATAAATATGTCGACAAATACGCTAATAAGCTTGTAAGATCAACTGGAGCGCTCTTAATT
TGAGATTATATATAGATATTTTGATTTTACCGATGGTAGCAGATTCAGTACACCGCACGAGAATGCGTTTTCCGTGATTAGTCGGTCGCCGCCACCCAAG
ATGTCAGAAACTCTCCCTTTTCCTGAGCGTGAAAGAAAACGGGTGGTTTGCAGACCCGTGCGCCGTTTGGGCCTGACGCCAGAACAGGATTGGAAGAGTG
GAGGAGAGGAGTCCGTAACGATCTCTTCGTGCACTCAGCTTCCACATGAGCAGCATCCGCATGAGCGCGTCCACTGTGCGCCTTGCAACAAACCTTTCGA
TCGTCCTATTTCATCTTCTGCTGTGGCGTCGATAACATAGGACGCTCCCACCACAAGCCACATGCGCTTCTACCCTGTAGCCAAAATGGTATGAGCTGAC
TGCTACTTGCCAACCGGATTTCCACCGCATCGCTCATGATTGATACGTAAAACGATTGCGAAACTCGTGCTCACTCATACGACACGGACGTTGGCGACGT
GGCTCTCTGATTGACAACTCGTCCGAATTTGCACAGGAAACCGCCGTGTTGATGGTGAATGCGCATTCGACACCAAGCAGAAAAAAACTGAGTGATCAAG
TTTCACAGGTTTAAGCCCATCTTGGGGTGCAAGGTTGCCCTTTCAGCTTCACAGTTCAGACCGTCCGCCAAAAAGCGACTTTCATCGCGTTGGTCATGCA
CTAGTAGAAACGAAAGTGGTGGGAAGAGCAGCGGAGTAAGTGAAGAAGATGACAGGCTGTGTGCGCGAGTATCAGGGCGAGGGAGAAACTTTGATGCTGT
AGGTGTGTGTGCATAGATGGAAGGAAGGTAGTGCCGAGTGCGAGTACGAGCACTCGCGAGTCAATGGCACGAGGTGAAAGAGAATTTTGTGAGTATGAAA
GAATGCACATAGGCGTCATTTCCTCTCGACTGGCTTGCTGCCTCCGCAGTTTAGAGTCTTTCGTAAGTCAGCGTGATTTTCATGAGGAATAGACGGGAGT
ACGCTGAGATGTCTACGACATATAAAATCAATCCATTCATGCTTGCTTGCTTGTAATAGCAAGGAAGCAGAGTCGGCAAGAGCGCACAAGCCCCCATCAG
ACGGGATTCTTTGGGTGCAGTCAGTTCGCGGTACAGTTAAGGCACTCTCCACGCAAGTCGCATGTTTTGGAAACTTGGAATGACTAGAATTCCAGTTCTA
GTTCCAGTACTGGAACTCCTTGAACCCATTTTTGAGGTGGTCCACCTTAAATCGACCCAAAAGATACGACGTAGTTTGAAGTATTAAGATCGAGCAGCTT
CACATTACTTGGGGCCAAATGGACTCGCTGCCATTGGCGCTGTACATCGCACTGCTGATCGTCGTGTGGCAGCTTACGACCTCCTCCAACTACGCACTGG
CGCTCCTCATTCCGCCGCACACGGACGGTAATGACCCAGTACTGCAAGCGATTCTTAAGAGCTCAACGTCGGACGCGTTTGTAGGTCTTCGCTTCGATGT
CCCTCTGCAAATGACGGCATCTGGTAATGACGACCAGGAGGATACTCGGTCTATCATGCTGGAGACACAGGCGCTTGCAGCCGATCTGCGGTGCTTTGGG
TGGATTCAACCTAGCGTTCCCAAGGTGTTGTATGTGGCTTTGCGATTGCTGCTGTTGTATTGCTTGCTCATATCGTGTGTGGTGAATATTGCAACGTTAG
CGACTTGTGGGTGAAGCGAGGTGCCCCACGCAGATCGCTGCGTCTGCTCTAATCGCGCACCTCAAACAGCCAAATGGTAGCGATCATGACAGCGAGTTCT
TGTTTTATAAAAACACAAAGATTCGCTTCCACTTTGCCACCTTTCGCGTGCTCTCGGAGCCAAAGTACCAAGGGAAGACGTGCTTCAAGACGCCGCCACA
TGCGTGTCCTAGTAGGGGTGACAATGGCGGCAATGGAAGGAGACCCACAGCACCACTTGGTTCGGTAGATACGACAACAAGGGACGAGCTGTAGCATTCA
ACAACAACAAAAGTGTCTTTTGTAACAAAAAAAGGTTGTTCCTCGTCTAATAACTATAAAAGAGAGACTGCATGCTTCTGCTTCGCGTTGCGTCTTCTTG
CTCGACTGACTATTCATTTCTACCGGTGCTGCTGCGTCGTGTGCATGTACGTCGCGTTCTGGTTGGCCATGTTATACGCGCGCTCGGCCGCCATCTGGAG
CTCGAGCATCTGGTTATAGAGCCCCGCGCGCGTCTGGTTGTTGTTGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTACGCGCCGCCGATGTG
CTGTTGCTGAGGCGCATACCCTTGCTGCTGCTGAGGAGGAGGAGCGTAGCCTGCGTGGAGTGGCGTCATGTGCGAAGTCGTTGGCTGCTGCTGAGGAAGG
TAGTGCATCTGGTGCTGATTCGACTGCACGAGCTGGTTCTGCGATCCGTACCGTGTAAGTTGCTGTTGCTGCTGTGGTGGTTGGTGCTGAGGTTGTTGCT
GGAAGCCGTAGCCTGGACCGGCATCTGTTGCCGCCATCCGTTTGCGGTCCATGAGCACCATTTGCGAGCCGTGCTCCTCGGGGGTCTGCTGCAGAGTTGG
GTAGTACGATTGGTCGTCGAGATCCGAGTACGTCGATGACACGGAGCTTGAGGGCCACGACTGCATCGATTGCGAGTACTCGGTCTCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGACGCCTTCGAACGGCGACGTGTCCTTGACGTTCACGAGACAGATCTTGCAG
CACGACACCTTGATCTTGCCCTTGCGCGAAAAAGTCTGCTTCTTGACGCGGCACTTGGTGCAGATCACGCACCCGCAGCCTTGACACGTGAGATGAGACG
AGAGCAAACCCGGTTTCGCGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGTCGGCCGTCGAGTCGAACGCGCCCTCCATGAACACGTCCACGAGTCCGGGCTGCGAGCTTTCGCGGAATAAATAGCAAAAAGACAT
GTTGGTGCGCACGATCGAGTTGTCGGCGAACGGCGGACAGTTGCCCACAGGCACGGACTCGAGCACATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCATCTCCTC
CGTGGATGATTCGTGGAGCCCGTAGATGATGTCATCAACCGAGCCTTCGATGAGTCCAAAGCCCAGTACCGACGGTGCGATGGACTTGCGCGACACGTCG
TCATAACTGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGGACTTGGCGAGTTTCCACGTGCGCGAGTCGATGCTCATCTTGCCGTCGCGCACGTAGTGGAGTTGGTCGCGGCGCGTCTCCTTCACGATGTCG
GTCACAAGGCTCTGGAACGCCATCGTCTCGTCCGGCGTGAGTTCGAACTTGGGGAAGTACCCC