Description :
From Genome Similarity Track
Location :
Scaffold_37:103891- 105496
Sequence
1605 bases(100 bases per row)
GTTATACTTGGTAGCACTCGTAGTCAATCCTACACCAGAGTCTACAAGACTTGCCCCCTTTGAGATGGCGAACCTTTCCTACCTCTCTGAGGCTGAACGC
CTGGCCCCAGATAAAATATCGCTTTGATAGGTGCCGAACAAGTGATCCTCATTGTGGCGCACGGTCAAGACCTGCTAAAAGCACGCCTGGACGCCTTTTA
AAAATTTGAAGCCACGTTAATCGGTCAGGTTTATGACCACGTGGTATCGGCTTGCCAACTTGCTATGTACACATAACTATAGATGAGCCTAAGGGTCGAC
CACTCGTTCTAATCCTTATTGCTGTCGAGGCAAAAGGAAGGTAACCTCCTTCTCCAGATTTTGGAAACTATATGGCAATGAGTGCCGCTGTGTTCAAGTC
TGAGATACAACAAGTTGACATGGCCATTTCCAAACTAGGCGGCAGAGCTAGAGAATGGGCACTAACGTGTGACGTGTCTGTAAACGCCGCCTTTTCCATG
TGTAACTCGCTCAAGAGACAATTGTTTTGAGGTCCACACCACCTAATCAATCATATGGTATGAGATCATAATTTTTAGCTGCCCGCCAGGATAGGAAAGA
ATTACGGACTATGTCCAGGAGCGGCAAACGCTTCTTGCAGCTATGCAGCTGGATACTTTTCCAGAAGACGTCCGCATGACCATACATATAGAAGGAATCT
GTACCGGAGTTTTACGGAAGTCTTTCAATTCCACCGCCTACCTTTGATGAGGCAGTAACAGATTGCGTTGAGCACTGAATTTAACTTCAAAGCACCTCGC
TACAGTACCCATAAGAATCAGACGAGTACGTTGGATATACCTGAGCCCATGGATCTCAGCTATGCTGAAGGTGGCGAGGCTGAGCTTAAGCTGTGGTACA
TCGCCATTACATCCGTAGATGTCTTACGCTCGGAAGCACGATGCATCTCCGCCCCTACTGTATACTTCGTACGGCAGTATCGGTCGAACTGAAACCGGCG
CCGACCCGGAAAGCGGGCATGGCGCGGGAAAATGTAGACTTTTAGTAGGCGCGGGGCGCCCTTATTTCTTATTATGCATTTTGAAACAATTTTCTTTTAC
ACTTTTTCAATTATAGCTTTAACTTCTGCTACTGGGGAAGAACTAGGTTATGTAGTATCTCTAGAAGGTAGGAGGAATTAGGATATATACCCAATGATCT
CCGTAGGTGTTGTGACGGAGCATGGATACAATCCAGGATTGTTAGTTGTGACAGCATCAGTGAAAGGCTTAGAAAAGCCACGTTCAGTTCTAATTGACTC
AGGTGCGTCTGCTAATTATGTCCGACTTCAGTCCCTTGAAGAGAAGCAACAATATGCCGAGGCGCACCAAGCACAGGAGGTGATGAAATCACGGCCGTCC
AGCAACAGGAGCACGAGTCACCACCCCGAAGTTTTGCTGAGCTTAGGGTTGAAATTTATGACTTCGACAACATCGAACGTTGTCTTGTCTTGGATTTAGA
ATTGATAACGATCCCATTCTTGGTATGGCTTGGCTTGAACGCCATGTGCCCCAAATTAATTAAGAGGACAAAACTATGGGCACCACACGCAATGTTCCTA
GCGAA