Description :
From Genome Similarity Track
Location :
Scaffold_519:10388- 12534
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.22Glycoside hydrolase
Pytve_DAOMBR484maker-pve_contig_519-snap-gene-0.23Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_519-fgenesh-gene-0.4Acetolactate synthase small subunit

Sequence
2146 bases(100 bases per row)
TCGTACACTCTGGCCCACTTGGGCTGCACGGCGATCCCCAGCACGGGACTAAACACCCACGGGATGTCCGCCGCCAGCGTCTCCTTCGCCGATACCTCGG
CCATCGCTCCCATCAGGCGAGGGTCGAACGTCGCGGCGGCGGCGATGGCCTGCGGGAACAGCGTCGCTCCTCGAACGTACGTGGCGCCGTGGATCGAATC
GACTCCGTACAGCACTGGAGCGGCGCCATGTTCTCTGTATATCGCCTGGATCTGTGCGATCACAGTGCGCCACTCGGACGCGGTCCAGCCCGTGCGATCA
TCGGCCATCGGACCGCCGAACGGCGCGTTGAAGATGGAGCCGATGCCGAGCTTGGCGATGGCCGCGACGCTCGCGTTGTTCAGAGCTCGCGCCGGCTCAC
GCTCGCCGCCGTTCATGAGCGAGTTGATGTCGACCTGCGTCATCTGCGCCGCCTTCTCGCGCACCGTCTAGACGAACACCGGAGCCACCAAAGCCGACAG
TCAGTTCTGTAGGGCTGTGTGGATCCTCATATCCGATCGAGAAAGGACGACCATGGAGCTGAGCAGCTTGGCGACCACCGCATCGTCCGAGAAGCCGCGC
AGGTCAGCCACCGTCGGGTCGAAGACGTCGGCGGCCGACGCCGACAGCAGCAGCGGCGGCGATAGCAGCAGTAGCAGGTTGAAGCAGAGTGCCACAAGCA
TTTTCCCCGGCCAAGCTACTGTCATCAGAGCGGGCTGAGGCGAGGCTCCCCTTCTTTCCCCATCGCTTGGACCAACCGTGAATGCGCATTCGGGTCCGTT
TTAGCGTGGACAGCACGGTACTATTCTCATCAAGACTAGTGATTGGCTGAAATATGATGCGTAACCTTGCTGTGCTGGCACGAGCATTCGATGCGCATTG
CGGCGCCGGCGCTTGATGAATGGAGACGCCGCTTGCATCATCACATCGGTATCGACCATGCGCCGACGATCTGCCTGCATCTCATGCCAGGGACGCGCGG
GGAGGCTCGCTACGCGCAGATATGGCCCAGTGTACCCCCACCACCAAGATACCATAACCTCTCGGTGATTGGACGAAAATACCAAATAGTTTAAAACACC
TGGCTCGCCGCGCCGGTTCCGCCGCTGGTTCCGGCGCCGATCTCGTGGGGCAGCAGCGGCATGCGACCAGCGGCCGCGAGACCAGCAGCACTTTGCCATT
TGCGGCGCGCGTCACGTCCCAGGGCCGAGCCAGTCGCACCCACAGAACCGCCAGCATGCTGAGGCGACAGGTCGTGTCGGCGCTCGCGCGGCGGGCGATC
GCCCCGCGCGCGGCGTCGCTTGGCATCCAGCAGCAGGTCGCGCGCTTCGCGAGCGCGGCCGAGCAGAGCCGGCGCCACGTGATCGCGGCGCTCGTGGTCA
ACCAGCCGGGCTGTCTCGCCGAGATCGCCAACCTGTTCGCGGCCCGCGGTGCGTAGTCGATGGTGGTTGGTTGGTTATTGGTTGAGTACATGGAGACTGA
CTGGATGTTTGGTGTGGTTGGGTGTGGCTAGGCTACAACATTGACAGTCTCGTGGTCGGCCGCACCGAGGTGGAGGAGCTCTCGCGGATGACGGTCGTCG
TCAACGGCACCGACCAGAGCGTCGTCAACGTGAGTCCGCTGGCTGATTGGTTGGTTTGTGCATCTCGCTCGGACGGAGACTGAACTGTGTCATGCTGGTG
TCTATTGCAGATGAAGAAGCAGCTCGAGGACGTGGTGCACGTCGCGGTCGTCAATATCCTGAGCAGCGGCTTCGGCGGACAGAAGAACTACGTCGAGCGG
GATCTGATGCTCGCCAAGGTCTCCACCGTCGGTGCGTCCGTTGTTGTTCATCCCACTCCCTTGTTGGACCACCGAAACTCACATGTTGACCTCTAACTTG
ATGACAGAATCCGGCTCGCGCGCCGAGGTCGTGGAGCTCGCGACGCTGTTCGACGCCAAGGTGATCGACGTGCGGCCGCACCAGGTGATGGTGCAGCTCG
CCGGCCAGCCGGACCGCATCGAGGCGTTCCTCGAGCTGCTCAAGCCGCTCGGCATCACGGAGATCCACCGTTCGGGTGTGATCGCCATGGCGCGCAGCAC
CACGGTGGCCGAGGAGCTCGGCGACGTGACGTTCGAGGGAGCCACC